ncRNA ID | bra-miR5654a |
Species | Brassica rapa |
Class | miRNA |
Genome position | chrA6:20504780-20504974 [+] |
Reference genome | Brapa_1.1 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 62 - AUAAAUCCCAAGCAUCAUCCA - 82 |
Stem-loop(if miRNA) |
UAA   -UG     -   CU   CGUUUCU  UUC  -U          --UC   UAUUA                          CC    U    C  GA    UGA   UAUUG UAG  CUG       UG   GU  CACUCUUUUG    AGG     ACAAGAUAAAUCCCAAGCAUCAUCCA  UUAU AGCC UU  A    |||   ||||| |||  |||       ||   ||  ||||||||||    |||     ||||||||||||||||||||||||||  |||| |||| ||    ACU   GUAAC AUC  GAU       AC   CG  GUGAGAAAAU    UCC     UGUUUUAUUUAGGGUUCGUAGUAGGU  AAUG UCGG AG  C -AG   UUA     C   AG   -------  CUC  UU          CUUC   UCUCA                          AA    U    A  UA |
Stem-loop sequence | UAAUGAUGUAUUGUAGCUCUGCGUUUCUUGUUCGUUCACUCUUUUGUCAGGUAUUAACAAGAUAAAUCCCAAGCAUCAUCCACCUUAUUAGCCCUUGAACAUGAAGGCUUGUAAAAUGGAUGAUGCUUGGGAUUUAUUUUGUACUCUCCUCUUCUAAAAGAGUGUUGCCUCCAUAGGACUACCAAUGAUUUCAGA |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
XM_009112378.2 |
|
1.5 | PREDICTED: Brassica rapa pentatricopeptide repeat-containing protein At3g22470, mitochondrial-like (LOC103836144), mRNA | pentatricopeptide repeat-containing protein At3g22470, mitochondrial-like(LOC103836144) | coding protein | psRNATarget | |||||||||
XM_009119806.2 |
|
1.5 | PREDICTED: Brassica rapa pentatricopeptide repeat-containing protein At3g22470, mitochondrial-like (LOC103843103), mRNA | pentatricopeptide repeat-containing protein At3g22470, mitochondrial-like(LOC103843103) | coding protein | psRNATarget | |||||||||
XM_018655415.1 |
|
2.5 | PREDICTED: Brassica rapa probable disease resistance protein At1g12280 (LOC103843924), mRNA | NA | coding protein | psRNATarget | |||||||||
XM_018654457.1 |
|
2.5 | PREDICTED: Brassica rapa pentatricopeptide repeat-containing protein At1g12300, mitochondrial (LOC103843107), mRNA | NA | coding protein | psRNATarget |
1 | PMID:22025521
"Identification of conserved and novel microRNAs that are responsive to heat stress in Brassica rapa"; Yu X, Wang H, Lu Y, de Ruiter M, Cariaso M, Prins M, van Tunen A, He Y; J Exp Bot. 63:1025-1038(2012). |