Search result

BaseInfo

ncRNA ID	bna-miR394b
Species	Brassica napus
Class	miRNA
Genome position	EM:AC189295:85927-86038 [+]
Reference genome	BrassicaDB-20080411
Source	miRBase
Length	20
Mature sequence(if miRNA)	13 - UUGGCAUUCUGUCCACCUCC - 32
Stem-loop(if miRNA)	--UU     GA   -      U C              -------  - U     U   U     ACAGA  UCU UUGGCA U UGUCCACCUCCCCU       AC C AUGUA AUG G     |||||  ||| |||||| | ||||||||||||||       || | ||||| ||| U     UGUCU  AGA AACCGU A ACGGGUGGAGGGGG       UG G UGCAU UAU A GGAU     AG   C      C U              AGUGUUU  U U     C   U
Stem-loop sequence	UUACAGAGAUCUUUGGCAUUCUGUCCACCUCCCCUACCUAUGUAUAUGUGUAUUAUCUACGUUGUGUUUUGUGAGGGGGAGGUGGGCAUACUGCCAACAGAGAUCUGUUAGG

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
XM_013797750.1	ncRNA:20   CCUCCACCUGUCUUACGGUU   1   ||||||*||||||||||||| targets:1012   GGAGGUUGACAGAAUGCCAA   1031 Target Full Sequence	1.0	PREDICTED: Brassica napus F-box only protein 6-like (LOC106358015), mRNA	F-box only protein 6-like(LOC106358015)	coding protein	psRNATarget
XM_013866187.1	ncRNA:20   CCUCCACCUGUCUUACGGUU   1   ||||||*||||||||||||| targets:1246   GGAGGUUGACAGAAUGCCAA   1265 Target Full Sequence	1.0	PREDICTED: Brassica napus F-box only protein 6-like (LOC106425452), mRNA	F-box only protein 6-like(LOC106425452)	coding protein	psRNATarget
XM_013842388.1	ncRNA:20   CCUCCACCUGUCUUACGGUU   1   ||||||*||||||||||||| targets:1321   GGAGGUUGACAGAAUGCCAA   1340 Target Full Sequence	1.0	PREDICTED: Brassica napus F-box only protein 6 (LOC106401800), mRNA	F-box only protein 6(LOC106401800)	coding protein	psRNATarget
XM_013807079.1	ncRNA:20   CCUCCACCUGUCUUACGGUU   1   ||||||*||||||||||||| targets:1350   GGAGGUUGACAGAAUGCCAA   1369 Target Full Sequence	1.0	PREDICTED: Brassica napus F-box only protein 6-like (LOC106367329), mRNA	F-box only protein 6-like(LOC106367329)	coding protein	psRNATarget
XM_013844249.1	ncRNA:20   CCUCCACCUGUCUUACGGUU   1   *|||**|||||||||||||| targets:975   UGAGAAGGACAGAAUGCCAA   994 Target Full Sequence	2.0	PREDICTED: Brassica napus putative two-component response regulator-like APRR6 (LOC106403423), mRNA	putative two-component response regulator-like APRR6(LOC106403423)	coding protein	psRNATarget

Reference

1	PMID:22138974 "Small RNA profiling in two Brassica napus cultivars identifies microRNAs with oil production- and development-correlated expression and new small RNA classes"; Zhao YT, Wang M, Fu SX, Yang WC, Qi CK, Wang XJ; Plant Physiol. 158:813-823(2012).