Search result

BaseInfo

ncRNA ID	ath-miR156g
Species	Arabidopsis thaliana
Class	miRNA
Genome position	chr2:8412516-8412618 [-]
Reference genome	TAIR10
Source	miRBase
Length	20
Mature sequence(if miRNA)	74 - CGACAGAAGAGAGUGAGCAC - 93
Stem-loop(if miRNA)	AUAACGA   C    -               A  U    CUUU   U     G        AGG GACA GAAGAGAGUGAGCAC CA GGCU    UUC AGCAU C        ||| |||| ||||||||||||||| || ||||    ||| |||||        UCC CUGU CUUCUCUCAUUCGUG GU UCGA    AAG UCGUA U UCUCUCG   U    U               C  C    ----   C     C
Stem-loop sequence	AUAACGAAGGCGACAGAAGAGAGUGAGCACACAUGGCUCUUUUUCUAGCAUGCUCAUGCUCGAAAGCUCUGCGUGCUUACUCUCUUCUUGUCUCCUGCUCUCU

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
NM_128940.2	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   *||||=|||||||||||||* targets:787   UUGCUUACUCUCUUCUGUCA   806 Target Full Sequence	2.0	Arabidopsis thaliana squamosa promoter binding protein-like 3 (SPL3), mRNA	squamosa promoter binding protein-like 3(SPL3)	coding protein	psRNATarget
AK118179.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   *||||=|||||||||||||* targets:564   UUGCUUACUCUCUUCUGUCA   583 Target Full Sequence	2.0	Arabidopsis thaliana At2g33810 mRNA for putative squamosa-promoter binding protein, complete cds, clone: RAFL19-50-A02	NA	coding protein	psRNATarget
AY084312.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   *||||=|||||||||||||* targets:520   UUGCUUACUCUCUUCUGUCA   539 Target Full Sequence	2.0	Arabidopsis thaliana clone 10375 mRNA, complete sequence	NA	coding protein	psRNATarget
AJ011633.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   *||||=|||||||||||||* targets:470   UUGCUUACUCUCUUCUGUCA   489 Target Full Sequence	2.0	Arabidopsis thaliana (ecotype Landsberg erecta) mRNA for squamosa promoter binding protein-like 3	NA	coding protein	psRNATarget
Y09427.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   *||||=|||||||||||||* targets:470   UUGCUUACUCUCUUCUGUCA   489 Target Full Sequence	2.0	A.thaliana mRNA for squamosa-promoter binding protein like 3	NA	coding protein	psRNATarget
AJ242959.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   *||||=|||||||||||||* targets:470   UUGCUUACUCUCUUCUGUCA   489 Target Full Sequence	2.0	Arabidopsis thaliana mRNA for Squamosa promoter binding protein-like 3 (SPL3 gene)	NA	coding protein	psRNATarget
NM_001332756.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:2739   GUGCUCUCUCUCUUCUGUCA   2758 Target Full Sequence	2.0	Arabidopsis thaliana squamosa promoter binding protein-like 10 (SPL10), mRNA	squamosa promoter binding protein-like 10(SPL10)	coding protein	psRNATarget
NM_102499.4	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:2630   GUGCUCUCUCUCUUCUGUCA   2649 Target Full Sequence	2.0	Arabidopsis thaliana squamosa promoter binding protein-like 10 (SPL10), mRNA	squamosa promoter binding protein-like 10(SPL10)	coding protein	psRNATarget
NM_001036019.3	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:2442   GUGCUCUCUCUCUUCUGUCA   2461 Target Full Sequence	2.0	Arabidopsis thaliana squamosa promoter binding protein-like 10 (SPL10), mRNA	squamosa promoter binding protein-like 10(SPL10)	coding protein	psRNATarget
NM_001332755.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:2372   GUGCUCUCUCUCUUCUGUCA   2391 Target Full Sequence	2.0	Arabidopsis thaliana squamosa promoter binding protein-like 10 (SPL10), mRNA	squamosa promoter binding protein-like 10(SPL10)	coding protein	psRNATarget
NM_102498.3	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:2330   GUGCUCUCUCUCUUCUGUCA   2349 Target Full Sequence	2.0	Arabidopsis thaliana squamosa promoter-like 11 (SPL11), mRNA	squamosa promoter-like 11(SPL11)	coding protein	psRNATarget
AY074853.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:2354   GUGCUCUCUCUCUUCUGUCA   2373 Target Full Sequence	2.0	Arabidopsis thaliana At1g27370/F17L21_16 mRNA, complete cds	NA	coding protein	psRNATarget
NM_001084135.2	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:2227   GUGCUCUCUCUCUUCUGUCA   2246 Target Full Sequence	2.0	Arabidopsis thaliana squamosa promoter-like 11 (SPL11), mRNA	squamosa promoter-like 11(SPL11)	coding protein	psRNATarget
NM_001084134.2	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:2123   GUGCUCUCUCUCUUCUGUCA   2142 Target Full Sequence	2.0	Arabidopsis thaliana squamosa promoter-like 11 (SPL11), mRNA	squamosa promoter-like 11(SPL11)	coding protein	psRNATarget
NM_180791.3	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:1891   GUGCUCUCUCUCUUCUGUCA   1910 Target Full Sequence	2.0	Arabidopsis thaliana squamosa promoter binding protein-like 2 (SPL2), mRNA	squamosa promoter binding protein-like 2(SPL2)	coding protein	psRNATarget
NM_124435.3	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:1634   GUGCUCUCUCUCUUCUGUCA   1653 Target Full Sequence	2.0	Arabidopsis thaliana Squamosa promoter-binding protein-like (SBP domain) transcription factor family protein (SPL13A), mRNA	Squamosa promoter-binding protein-like (SBP domain) transcription factor family protein(SPL13A)	coding protein	psRNATarget
NM_203146.4	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:1807   GUGCUCUCUCUCUUCUGUCA   1826 Target Full Sequence	2.0	Arabidopsis thaliana squamosa promoter binding protein-like 2 (SPL2), mRNA	squamosa promoter binding protein-like 2(SPL2)	coding protein	psRNATarget
NM_202192.2	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:1507   GUGCUCUCUCUCUUCUGUCA   1526 Target Full Sequence	2.0	Arabidopsis thaliana squamosa promoter binding protein-like 10 (SPL10), mRNA	squamosa promoter binding protein-like 10(SPL10)	coding protein	psRNATarget
NM_180830.4	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:1264   GUGCUCUCUCUCUUCUGUCA   1283 Target Full Sequence	2.0	Arabidopsis thaliana Squamosa promoter-binding protein-like (SBP domain) transcription factor family protein (SPL13A), mRNA	Squamosa promoter-binding protein-like (SBP domain) transcription factor family protein(SPL13A)	coding protein	psRNATarget
NM_105584.6	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:1297   GUGCUCUCUCUCUUCUGUCA   1316 Target Full Sequence	2.0	Arabidopsis thaliana Squamosa promoter-binding protein-like (SBP domain) transcription factor family protein mRNA	Squamosa promoter-binding protein-like (SBP domain) transcription factor family protein(AT1G69170)	coding protein	psRNATarget
NM_001344905.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:1283   GUGCUCUCUCUCUUCUGUCA   1302 Target Full Sequence	2.0	Arabidopsis thaliana Squamosa promoter-binding protein-like (SBP domain) transcription factor family protein (SPL13B), mRNA	Squamosa promoter-binding protein-like (SBP domain) transcription factor family protein(SPL13B)	coding protein	psRNATarget
NM_129782.3	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:1175   GUGCUCUCUCUCUUCUGUCA   1194 Target Full Sequence	2.0	Arabidopsis thaliana squamosa promoter binding protein-like 9 (SPL9), mRNA	squamosa promoter binding protein-like 9(SPL9)	coding protein	psRNATarget
BX815862.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:1267   GUGCUCUCUCUCUUCUGUCA   1286 Target Full Sequence	2.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH13ZC06 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
NM_123693.6	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:1256   GUGCUCUCUCUCUUCUGUCA   1275 Target Full Sequence	2.0	Arabidopsis thaliana squamosa promoter binding protein-like 2 (SPL2), mRNA	squamosa promoter binding protein-like 2(SPL2)	coding protein	psRNATarget
NM_202191.2	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:1398   GUGCUCUCUCUCUUCUGUCA   1417 Target Full Sequence	2.0	Arabidopsis thaliana squamosa promoter-like 11 (SPL11), mRNA	squamosa promoter-like 11(SPL11)	coding protein	psRNATarget
NM_001084136.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:1315   GUGCUCUCUCUCUUCUGUCA   1334 Target Full Sequence	2.0	Arabidopsis thaliana squamosa promoter binding protein-like 10 (SPL10), mRNA	squamosa promoter binding protein-like 10(SPL10)	coding protein	psRNATarget
AJ011625.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:1165   GUGCUCUCUCUCUUCUGUCA   1184 Target Full Sequence	2.0	Arabidopsis thaliana (ecotype Landsberg erecta) mRNA for squamosa promoter binding protein-like 2	NA	coding protein	psRNATarget
AK227964.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:1122   GUGCUCUCUCUCUUCUGUCA   1141 Target Full Sequence	2.0	Arabidopsis thaliana mRNA for squamosa promoter binding protein-like 6, complete cds, clone: RAFL14-51-E10	NA	coding protein	psRNATarget
NM_124445.4	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:1264   GUGCUCUCUCUCUUCUGUCA   1283 Target Full Sequence	2.0	Arabidopsis thaliana Squamosa promoter-binding protein-like (SBP domain) transcription factor family protein (SPL13B), mRNA	Squamosa promoter-binding protein-like (SBP domain) transcription factor family protein(SPL13B)	coding protein	psRNATarget
BT004327.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:1186   GUGCUCUCUCUCUUCUGUCA   1205 Target Full Sequence	2.0	Arabidopsis thaliana clone RAFL15-31-G21 (R50184) At5g43270 mRNA, complete sequence	NA	coding protein	psRNATarget
BX816068.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:1296   GUGCUCUCUCUCUUCUGUCA   1315 Target Full Sequence	2.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH26ZB04 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
NM_001332754.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:1193   GUGCUCUCUCUCUUCUGUCA   1212 Target Full Sequence	2.0	Arabidopsis thaliana squamosa promoter binding protein-like 10 (SPL10), mRNA	squamosa promoter binding protein-like 10(SPL10)	coding protein	psRNATarget
BX832034.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:1352   GUGCUCUCUCUCUUCUGUCA   1371 Target Full Sequence	2.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH47ZH02 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AY046007.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:937   GUGCUCUCUCUCUUCUGUCA   956 Target Full Sequence	2.0	Arabidopsis thaliana putative squamosa-promoter binding protein (At2g42200) mRNA, complete cds	NA	coding protein	psRNATarget
AY070106.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:1253   GUGCUCUCUCUCUUCUGUCA   1272 Target Full Sequence	2.0	Arabidopsis thaliana putative squamosa-promoter binding protein 2 (At1g27360) mRNA, complete cds	NA	coding protein	psRNATarget
BX831680.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:1103   GUGCUCUCUCUCUUCUGUCA   1122 Target Full Sequence	2.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH23ZD07 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AJ011643.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:979   GUGCUCUCUCUCUUCUGUCA   998 Target Full Sequence	2.0	Arabidopsis thaliana (ecotype Columbia) mRNA for squamosa promoter binding protein-like 6	NA	coding protein	psRNATarget
AK317730.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:1042   GUGCUCUCUCUCUUCUGUCA   1061 Target Full Sequence	2.0	Arabidopsis thaliana AT5G50570 mRNA, complete cds, clone: RAFL25-16-N16	NA	coding protein	psRNATarget
AJ011626.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:1063   GUGCUCUCUCUCUUCUGUCA   1082 Target Full Sequence	2.0	Arabidopsis thaliana (ecotype Columbia) mRNA for squamosa promoter binding protein-like 2	NA	coding protein	psRNATarget
AK230160.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:1149   GUGCUCUCUCUCUUCUGUCA   1168 Target Full Sequence	2.0	Arabidopsis thaliana mRNA for squamosa promoter binding protein-like 2, complete cds, clone: RAFL22-87-G21	NA	coding protein	psRNATarget
NM_115654.3	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:845   GUGCUCUCUCUCUUCUGUCA   864 Target Full Sequence	2.0	Arabidopsis thaliana squamosa promoter binding protein-like 15 (SPL15), mRNA	squamosa promoter binding protein-like 15(SPL15)	coding protein	psRNATarget
BX818496.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:1178   GUGCUCUCUCUCUUCUGUCA   1197 Target Full Sequence	2.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL82ZC03 of Silique of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AY084609.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:1025   GUGCUCUCUCUCUUCUGUCA   1044 Target Full Sequence	2.0	Arabidopsis thaliana clone 113229 mRNA, complete sequence	NA	coding protein	psRNATarget
AY093106.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:1073   GUGCUCUCUCUCUUCUGUCA   1092 Target Full Sequence	2.0	Arabidopsis thaliana unknown protein (At5g50570) mRNA, complete cds	NA	coding protein	psRNATarget
AJ011639.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:781   GUGCUCUCUCUCUUCUGUCA   800 Target Full Sequence	2.0	Arabidopsis thaliana (ecotype Landsberg erecta) mRNA for squamosa promoter binding protein-like 9	NA	coding protein	psRNATarget
BX832762.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:1111   GUGCUCUCUCUCUUCUGUCA   1130 Target Full Sequence	2.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH9ZD01 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AY088185.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:1195   GUGCUCUCUCUCUUCUGUCA   1214 Target Full Sequence	2.0	Arabidopsis thaliana clone 42666 mRNA, complete sequence	NA	coding protein	psRNATarget
BX815562.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:1212   GUGCUCUCUCUCUUCUGUCA   1231 Target Full Sequence	2.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS71ZF01 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AK117475.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:968   GUGCUCUCUCUCUUCUGUCA   987 Target Full Sequence	2.0	Arabidopsis thaliana At5g50670 mRNA for unknown protein, complete cds, clone: RAFL17-08-M12	NA	coding protein	psRNATarget
AY086384.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:785   GUGCUCUCUCUCUUCUGUCA   804 Target Full Sequence	2.0	Arabidopsis thaliana clone 247919 mRNA, complete sequence	NA	coding protein	psRNATarget
AJ011637.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:1122   GUGCUCUCUCUCUUCUGUCA   1141 Target Full Sequence	2.0	Arabidopsis thaliana (ecotype Columbia) mRNA for squamosa promoter binding protein-like 10	NA	coding protein	psRNATarget
AJ011638.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:775   GUGCUCUCUCUCUUCUGUCA   794 Target Full Sequence	2.0	Arabidopsis thaliana (ecotype Columbia) mRNA for squamosa promoter binding protein-like 9	NA	coding protein	psRNATarget
AJ011635.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:1122   GUGCUCUCUCUCUUCUGUCA   1141 Target Full Sequence	2.0	Arabidopsis thaliana (ecotype Columbia) mRNA for squamosa promoter binding protein-like 11	NA	coding protein	psRNATarget
BT025984.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:1010   GUGCUCUCUCUCUUCUGUCA   1029 Target Full Sequence	2.0	Arabidopsis thaliana At5g43270 mRNA, complete cds	NA	coding protein	psRNATarget
BT006436.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:908   GUGCUCUCUCUCUUCUGUCA   927 Target Full Sequence	2.0	Arabidopsis thaliana At1g69170 gene, complete cds	NA	coding protein	psRNATarget
AY091286.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:1085   GUGCUCUCUCUCUUCUGUCA   1104 Target Full Sequence	2.0	Arabidopsis thaliana putative squamosa-promoter binding protein 2 (At1g27360) mRNA, complete cds	NA	coding protein	psRNATarget
AY142028.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:1085   GUGCUCUCUCUCUUCUGUCA   1104 Target Full Sequence	2.0	Arabidopsis thaliana At1g27370/F17L21_16 mRNA, complete cds	NA	coding protein	psRNATarget
AF370612.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:875   GUGCUCUCUCUCUUCUGUCA   894 Target Full Sequence	2.0	Arabidopsis thaliana similar to squamosa-promoter binding protein 1 isolog gi|1707009 (F4N2.13) mRNA, complete cds	NA	coding protein	psRNATarget
AY150378.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:743   GUGCUCUCUCUCUUCUGUCA   762 Target Full Sequence	2.0	Arabidopsis thaliana putative squamosa-promoter binding protein (At2g42200) mRNA, complete cds	NA	coding protein	psRNATarget
AJ628864.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:743   GUGCUCUCUCUCUUCUGUCA   762 Target Full Sequence	2.0	Arabidopsis thaliana mRNA for putative squamosa-promoter binding protein (At2g42200 gene)	NA	coding protein	psRNATarget
AY128816.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   ||||||*||||||||||||* targets:332   GUGCUCUCUCUCUUCUGUCA   351 Target Full Sequence	2.0	Arabidopsis thaliana unknown protein (At5g50570) mRNA, complete cds	NA	coding protein	psRNATarget
NM_104194.4	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   *|||||*||||||||||||* targets:750   CUGCUCUCUCUCUUCUGUCA   769 Target Full Sequence	2.0	Arabidopsis thaliana squamosa promoter binding protein-like 4 (SPL4), mRNA	squamosa promoter binding protein-like 4(SPL4)	coding protein	psRNATarget
AY084902.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   *|||||*||||||||||||* targets:586   CUGCUCUCUCUCUUCUGUCA   605 Target Full Sequence	2.0	Arabidopsis thaliana clone 12071 mRNA, complete sequence	NA	coding protein	psRNATarget
BT002856.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   *|||||*||||||||||||* targets:593   CUGCUCUCUCUCUUCUGUCA   612 Target Full Sequence	2.0	Arabidopsis thaliana clone RAFL15-05-B10 (R20352) putative transcription factor (At1g53160) mRNA, complete cds	NA	coding protein	psRNATarget
AJ011632.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   *|||||*||||||||||||* targets:514   CUGCUCUCUCUCUUCUGUCA   533 Target Full Sequence	2.0	Arabidopsis thaliana (ecotype Landsberg erecta) mRNA for squamosa promoter binding protein-like 4, partial	NA	coding protein	psRNATarget
AJ011631.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   *|||||*||||||||||||* targets:558   CUGCUCUCUCUCUUCUGUCA   577 Target Full Sequence	2.0	Arabidopsis thaliana (ecotype Columbia) mRNA for squamosa promoter binding protein-like 4	NA	coding protein	psRNATarget
BX818213.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   *|||||*||||||||||||* targets:531   CUGCUCUCUCUCUUCUGUCA   550 Target Full Sequence	2.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL66ZF03 of Silique of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BT004391.1	ncRNA:20   CACGAGUGAGAGAAGACAGC   1   *|||||*||||||||||||* targets:535   CUGCUCUCUCUCUUCUGUCA   554 Target Full Sequence	2.0	Arabidopsis thaliana clone U20352 putative transcription factor (At1g53160) mRNA, complete cds	NA	coding protein	psRNATarget

Reference

1	PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"; Jones-Rhoades MW, Bartel DP; Mol Cell. 14:787-799(2004).
2	PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"; Rajagopalan R, Vaucheret H, Trejo J, Bartel DP; Genes Dev. 20:3407-3425(2006).
3	PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"; Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW; J Exp Bot. 61:165-177(2010).