ncRNA ID | ath-miR396a-3p |
Species | Arabidopsis thaliana |
Class | miRNA |
Genome position | chr2:4142323-4142473 [-] |
Reference genome | TAIR10 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 9 - GUUCAAUAAAGCUGUGGGAAG - 29 |
Stem-loop(if miRNA) |
C       UC            C            A -U  -UU    UUUUUUUUUUUU  UUUUGAUAUCUCUUACGC  UCUGUAU  UUCCACAGCUUU UUGAACUGCAAA C  UC   CAGA            UC                  A  |||||||  |||||||||||| |||||||||||| |  ||   ||||            ||  AGACAUA  AGGGUGUCGAAA AACUUGGCGUUU G  AG   GUCU            UA                  U C       GA            U            A UU  CUC    ---------CUA  CUUCUUUUAGUGAUAAAA |
Stem-loop sequence | CUCUGUAUUCUUCCACAGCUUUCUUGAACUGCAAAACUUCUUCAGAUUUUUUUUUUUUUCUUUUGAUAUCUCUUACGCAUAAAAUAGUGAUUUUCUUCAUAUCUCUGCUCGAUUGAUUUGCGGUUCAAUAAAGCUGUGGGAAGAUACAGAC |
1 | PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"; Jones-Rhoades MW, Bartel DP; Mol Cell. 14:787-799(2004). |
2 | PMID:16040653
"Expression of Arabidopsis MIRNA genes"; Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC; Plant Physiol. 138:2145-2154(2005). |
3 | PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"; Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC; Genome Res. 16:1276-1288(2006). |
4 | PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"; Rajagopalan R, Vaucheret H, Trejo J, Bartel DP; Genes Dev. 20:3407-3425(2006). |
5 | PMID:24119003
"Integrated RNA-seq and sRNA-seq analysis identifies novel nitrate-responsive genes in Arabidopsis thaliana roots"; Vidal EA, Moyano TC, Krouk G, Katari MS, Tanurdzic M, McCombie WR, Coruzzi GM, Gutierrez RA; BMC Genomics. 14:701(2013). |