Search result

BaseInfo

ncRNA ID ath-miR396a-3p
Species Arabidopsis thaliana
Class miRNA
Genome position chr2:4142323-4142473 [-]
Reference genome TAIR10
Source miRBase
Length 21
Mature sequence(if miRNA) 9 - GUUCAAUAAAGCUGUGGGAAG - 29
Stem-loop(if miRNA) C       UC            C            A -U  -UU    UUUUUUUUUUUU  UUUUGAUAUCUCUUACGC
 UCUGUAU  UUCCACAGCUUU UUGAACUGCAAA C  UC   CAGA            UC                  A
 |||||||  |||||||||||| |||||||||||| |  ||   ||||            ||
 AGACAUA  AGGGUGUCGAAA AACUUGGCGUUU G  AG   GUCU            UA                  U
C       GA            U            A UU  CUC    ---------CUA  CUUCUUUUAGUGAUAAAA
Stem-loop sequence CUCUGUAUUCUUCCACAGCUUUCUUGAACUGCAAAACUUCUUCAGAUUUUUUUUUUUUUCUUUUGAUAUCUCUUACGCAUAAAAUAGUGAUUUUCUUCAUAUCUCUGCUCGAUUGAUUUGCGGUUCAAUAAAGCUGUGGGAAGAUACAGAC

Reference

1 PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA";
Jones-Rhoades MW, Bartel DP;
Mol Cell. 14:787-799(2004).
2 PMID:16040653
"Expression of Arabidopsis MIRNA genes";
Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC;
Plant Physiol. 138:2145-2154(2005).
3 PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant";
Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC;
Genome Res. 16:1276-1288(2006).
4 PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana";
Rajagopalan R, Vaucheret H, Trejo J, Bartel DP;
Genes Dev. 20:3407-3425(2006).
5 PMID:24119003
"Integrated RNA-seq and sRNA-seq analysis identifies novel nitrate-responsive genes in Arabidopsis thaliana roots";
Vidal EA, Moyano TC, Krouk G, Katari MS, Tanurdzic M, McCombie WR, Coruzzi GM, Gutierrez RA;
BMC Genomics. 14:701(2013).