Search result

BaseInfo

ncRNA ID	ath-miRf11133-npr
Species	Arabidopsis thaliana
Class	miRNA
Genome position	NA
Reference genome	NA
Source	PNRD
Length	20
Mature sequence(if miRNA)	NA - UGGAUCAUCGUUGUAAGCAU - NA
Stem-loop(if miRNA)	C      A                                  GGAGAAAAGAAAC GUAUUU UUGUGG UCAUCGUUGUAAGCAUUAAUAAGAUUUAUUUUUU             U |||||| |||||| |||||||||||||||||||||||||||||||||| CAUAAA AAUAUU AGUAGUAACAUUCGUAAUUAUUCUAAAUAAAAAA             A       A      G                                  GAAUAAAAAAGUG
Stem-loop sequence	GUAUUUCUUGUGGAUCAUCGUUGUAAGCAUUAAUAAGAUUUAUUUUUUGGAGAAAAGAAACUAGUGAAAAAAUAAGAAAAAAUAAAUCUUAUUAAUGCUUACAAUGAUGAGUUAUAAAAAAUAC

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
BX816885.1	ncRNA:20   UACGAAUGUUGCUACUAGGU   1   ||||||=|||*||||||||| targets:1463   AUGCUUGCAAGGAUGAUCCA   1482 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH74ZF04 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AK229331.1	ncRNA:20   UACGAAUGUUGCUACUAGGU   1   ||||||=|||*||||||||| targets:1475   AUGCUUGCAAGGAUGAUCCA   1494 Target Full Sequence	2.5	Arabidopsis thaliana mRNA for cytochrome P450 like protein, complete cds, clone: RAFL16-58-J15	NA	coding protein	psRNATarget
AY084787.1	ncRNA:20   UACGAAUGUUGCUACUAGGU   1   ||||||=|||*||||||||| targets:1480   AUGCUUGCAAGGAUGAUCCA   1499 Target Full Sequence	2.5	Arabidopsis thaliana clone 117895 mRNA, complete sequence	NA	coding protein	psRNATarget
NM_101033.4	ncRNA:20   UACGAAUGUUGCUACUAGGU   1   ||||||=|||*||||||||| targets:1542   AUGCUUGCAAGGAUGAUCCA   1561 Target Full Sequence	2.5	Arabidopsis thaliana cytochrome P450, family 77, subfamily B, polypeptide 1 (CYP77B1), mRNA	cytochrome P450, family 77, subfamily B, polypeptide 1(CYP77B1)	coding protein	psRNATarget
BT025972.1	ncRNA:20   UACGAAUGUUGCUACUAGGU   1   *||||||||||*|||||||* targets:62   UUGCUUACAACAAUGAUCCU   81 Target Full Sequence	2.5	Arabidopsis thaliana At5g19550 mRNA, complete cds	NA	coding protein	psRNATarget
BX829537.1	ncRNA:20   UACGAAUGUUGCUACUAGGU   1   *||||||||||*|||||||* targets:151   UUGCUUACAACAAUGAUCCU   170 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB19ZF03 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
U15033.1	ncRNA:20   UACGAAUGUUGCUACUAGGU   1   *||||||||||*|||||||* targets:151   UUGCUUACAACAAUGAUCCU   170 Target Full Sequence	2.5	Arabidopsis thaliana aspartate aminotransferase (Asp2) mRNA, complete cds	NA	coding protein	psRNATarget
NM_121960.5	ncRNA:20   UACGAAUGUUGCUACUAGGU   1   *||||||||||*|||||||* targets:292   UUGCUUACAACAAUGAUCCU   311 Target Full Sequence	2.5	Arabidopsis thaliana aspartate aminotransferase 2 (ASP2), mRNA	aspartate aminotransferase 2(ASP2)	coding protein	psRNATarget