Search result

BaseInfo

ncRNA ID	ath-miR396a-5p
Species	Arabidopsis thaliana
Class	miRNA
Genome position	chr2:4142323-4142473 [-]
Reference genome	TAIR10
Source	miRBase
Length	21
Mature sequence(if miRNA)	121 - UUCCACAGCUUUCUUGAACUG - 141
Stem-loop(if miRNA)	C       UC            C            A -U  -UU    UUUUUUUUUUUU  UUUUGAUAUCUCUUACGC  UCUGUAU  UUCCACAGCUUU UUGAACUGCAAA C  UC   CAGA            UC                  A  |||||||  |||||||||||| |||||||||||| |  ||   ||||            ||  AGACAUA  AGGGUGUCGAAA AACUUGGCGUUU G  AG   GUCU            UA                  U C       GA            U            A UU  CUC    ---------CUA  CUUCUUUUAGUGAUAAAA
Stem-loop sequence	CUCUGUAUUCUUCCACAGCUUUCUUGAACUGCAAAACUUCUUCAGAUUUUUUUUUUUUUCUUUUGAUAUCUCUUACGCAUAAAAUAGUGAUUUUCUUCAUAUCUCUGCUCGAUUGAUUUGCGGUUCAAUAAAGCUGUGGGAAGAUACAGAC

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
BX822225.1	ncRNA:21   GUCAAGUUCUUUCG-ACACCUU   1   |*||||||||||||-||||||| targets:482   CCGUUCAAGAAAGCCUGUGGAA   503 Target Full Sequence	3.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB20ZH04 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BT026472.1	ncRNA:21   GUCAAGUUCUUUCG-ACACCUU   1   |*||||||||||||-||||||| targets:540   CCGUUCAAGAAAGCCUGUGGAA   561 Target Full Sequence	3.0	Arabidopsis thaliana At2g36400 mRNA, complete cds	NA	coding protein	psRNATarget
AY102637.1	ncRNA:21   GUCAAGUUCUUUCG-ACACCUU   1   |*||||||||||||-||||||| targets:580   CCGUUCAAGAAAGCCUGUGGAA   601 Target Full Sequence	3.0	Arabidopsis thaliana transcription activator (GRF4) mRNA, complete cds	NA	coding protein	psRNATarget
BX819097.1	ncRNA:21   GUCAAGUUCUUUCG-ACACCUU   1   |*||||||||||||-||||||| targets:731   CCGUUCAAGAAAGCCUGUGGAA   752 Target Full Sequence	3.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB46ZB11 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BX819325.1	ncRNA:21   GUCAAGUUCUUUCG-ACACCUU   1   |*||||||||||||-||||||| targets:725   CCGUUCAAGAAAGCCUGUGGAA   746 Target Full Sequence	3.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB69ZB02 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BX820895.1	ncRNA:21   GUCAAGUUCUUUCG-ACACCUU   1   |*||||||||||||-||||||| targets:720   CCGUUCAAGAAAGCCUGUGGAA   741 Target Full Sequence	3.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH79ZH08 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BX820563.1	ncRNA:21   GUCAAGUUCUUUCG-ACACCUU   1   |*||||||||||||-||||||| targets:746   CCGUUCAAGAAAGCCUGUGGAA   767 Target Full Sequence	3.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH48ZD11 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BX819392.1	ncRNA:21   GUCAAGUUCUUUCG-ACACCUU   1   |*||||||||||||-||||||| targets:741   CCGUUCAAGAAAGCCUGUGGAA   762 Target Full Sequence	3.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB74ZC12 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BX819886.1	ncRNA:21   GUCAAGUUCUUUCG-ACACCUU   1   |*||||||||||||-||||||| targets:741   CCGUUCAAGAAAGCCUGUGGAA   762 Target Full Sequence	3.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS43ZE03 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AK117417.1	ncRNA:21   GUCAAGUUCUUUCG-ACACCUU   1   |*||||||||||||-||||||| targets:742   CCGUUCAAGAAAGCCUGUGGAA   763 Target Full Sequence	3.0	Arabidopsis thaliana At2g36400 mRNA for unknown protein, complete cds, clone: RAFL17-02-B13	NA	coding protein	psRNATarget
NM_115151.3	ncRNA:21   GUCAAGUUCUUUCG-ACACCUU   1   |*||||||||||||-||||||| targets:800   CCGUUCAAGAAAGCCUGUGGAA   821 Target Full Sequence	3.0	Arabidopsis thaliana growth-regulating factor 4 (GRF4), mRNA	growth-regulating factor 4(GRF4)	coding protein	psRNATarget
AY102636.1	ncRNA:21   GUCAAGUUCUUUCG-ACACCUU   1   |*||||||||||||-||||||| targets:734   CCGUUCAAGAAAGCCUGUGGAA   755 Target Full Sequence	3.0	Arabidopsis thaliana transcription activator (GRF3) mRNA, complete cds	NA	coding protein	psRNATarget
NM_129197.4	ncRNA:21   GUCAAGUUCUUUCG-ACACCUU   1   |*||||||||||||-||||||| targets:1038   CCGUUCAAGAAAGCCUGUGGAA   1059 Target Full Sequence	3.0	Arabidopsis thaliana growth-regulating factor 3 (GRF3), mRNA	growth-regulating factor 3(GRF3)	coding protein	psRNATarget
AB493791.1	ncRNA:21   GUCAAGUUCUUUCG-ACACCUU   1   =*||||||||||||-||||||| targets:429   UCGUUCAAGAAAGCAUGUGGAA   450 Target Full Sequence	3.0	Arabidopsis thaliana At5g53660 mRNA for hypothetical protein, partial cds, clone: RAAt5g53660	NA	coding protein	psRNATarget
BT010882.1	ncRNA:21   GUCAAGUUCUUUCG-ACACCUU   1   =*||||||||||||-||||||| targets:429   UCGUUCAAGAAAGCAUGUGGAA   450 Target Full Sequence	3.0	Arabidopsis thaliana At5g53660 gene, complete cds	NA	coding protein	psRNATarget
AB493593.1	ncRNA:21   GUCAAGUUCUUUCGA-CACCUU   1   **|||||||||||||-|||||| targets:375   ACGUUCAAGAAAGCUUGUGGAA   396 Target Full Sequence	3.0	Arabidopsis thaliana At2g45480 mRNA for hypothetical protein, partial cds, clone: RAAt2g45480	NA	coding protein	psRNATarget
AY074647.1	ncRNA:21   GUCAAGUUCUUUCGA-CACCUU   1   **|||||||||||||-|||||| targets:379   ACGUUCAAGAAAGCUUGUGGAA   400 Target Full Sequence	3.0	Arabidopsis thaliana At2g45480/F4L23.1 mRNA, complete cds	NA	coding protein	psRNATarget
AK176109.1	ncRNA:21   GUCAAGUUCUUUCG-ACACCUU   1   =*||||||||||||-||||||| targets:529   UCGUUCAAGAAAGCAUGUGGAA   550 Target Full Sequence	3.0	Arabidopsis thaliana mRNA for putative protein, complete cds, clone: RAFL22-89-N21	NA	coding protein	psRNATarget
NM_001341644.1	ncRNA:21   GUCAAGUUCUUUCG-ACACCUU   1   =*||||||||||||-||||||| targets:762   UCGUUCAAGAAAGCAUGUGGAA   783 Target Full Sequence	3.0	Arabidopsis thaliana growth-regulating factor 8 (GRF8), partial mRNA	growth-regulating factor 8(GRF8)	coding protein	psRNATarget
BX820576.1	ncRNA:21   GUCAAGUUCUUUCGA-CACCUU   1   **|||||||||||||-|||||| targets:514   ACGUUCAAGAAAGCUUGUGGAA   535 Target Full Sequence	3.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH49ZG09 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
NM_118547.2	ncRNA:21   GUCAAGUUCUUUCG-ACACCUU   1   =*||||||||||||-||||||| targets:837   UCGUUCAAGAAAGCAUGUGGAA   858 Target Full Sequence	3.0	Arabidopsis thaliana growth-regulating factor 8 (GRF8), partial mRNA	growth-regulating factor 8(GRF8)	coding protein	psRNATarget
NM_180107.3	ncRNA:21   GUCAAGUUCUUUCGA-CACCUU   1   **|||||||||||||-|||||| targets:605   ACGUUCAAGAAAGCUUGUGGAA   626 Target Full Sequence	3.0	Arabidopsis thaliana growth-regulating factor 9 (GRF9), mRNA	growth-regulating factor 9(GRF9)	coding protein	psRNATarget
NM_124745.3	ncRNA:21   GUCAAGUUCUUUCG-ACACCUU   1   =*||||||||||||-||||||| targets:888   UCGUUCAAGAAAGCAUGUGGAA   909 Target Full Sequence	3.0	Arabidopsis thaliana growth-regulating factor 7 (GRF7), mRNA	growth-regulating factor 7(GRF7)	coding protein	psRNATarget
NM_001337134.1	ncRNA:21   GUCAAGUUCUUUCGA-CACCUU   1   **|||||||||||||-|||||| targets:612   ACGUUCAAGAAAGCUUGUGGAA   633 Target Full Sequence	3.0	Arabidopsis thaliana growth-regulating factor 9 (GRF9), mRNA	growth-regulating factor 9(GRF9)	coding protein	psRNATarget
NM_001337133.1	ncRNA:21   GUCAAGUUCUUUCGA-CACCUU   1   **|||||||||||||-|||||| targets:703   ACGUUCAAGAAAGCUUGUGGAA   724 Target Full Sequence	3.0	Arabidopsis thaliana growth-regulating factor 9 (GRF9), mRNA	growth-regulating factor 9(GRF9)	coding protein	psRNATarget
NM_001341645.1	ncRNA:21   GUCAAGUUCUUUCG-ACACCUU   1   =*||||||||||||-||||||| targets:1029   UCGUUCAAGAAAGCAUGUGGAA   1050 Target Full Sequence	3.0	Arabidopsis thaliana growth-regulating factor 8 (GRF8), mRNA	growth-regulating factor 8(GRF8)	coding protein	psRNATarget

Reference

1	PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"; Jones-Rhoades MW, Bartel DP; Mol Cell. 14:787-799(2004).
2	PMID:16040653 "Expression of Arabidopsis MIRNA genes"; Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC; Plant Physiol. 138:2145-2154(2005).
3	PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"; Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC; Genome Res. 16:1276-1288(2006).
4	PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"; Rajagopalan R, Vaucheret H, Trejo J, Bartel DP; Genes Dev. 20:3407-3425(2006).
5	PMID:24119003 "Integrated RNA-seq and sRNA-seq analysis identifies novel nitrate-responsive genes in Arabidopsis thaliana roots"; Vidal EA, Moyano TC, Krouk G, Katari MS, Tanurdzic M, McCombie WR, Coruzzi GM, Gutierrez RA; BMC Genomics. 14:701(2013).