ncRNA ID | novel_gar_miR1604 |
Species | Gossypium arboreum |
Class | miRNA |
Genome position | Chr10:111901276-111901463 [-] |
Reference genome | Gossypium_arboreum_v1.0 |
Source | SRR3180720 |
Length | 21 |
Mature sequence(if miRNA) | 1 - UCAAUGAUUGGACUAGGGUUU - 21 |
Stem-loop(if miRNA) |
--   G               CAC A            UUUUUUUUUUUUUUGGG         UGCA         -    G UUA  UAGU     AU   GCU   AUU UAGUCCAAUCAUUGA   C UUAGUAUUUUUU                 GUCAAAAUU    UACUAUCAG AUAU C   CU    UCAUA  GAU   U   ||| |||||||||||||||   | ||||||||||||                 |||||||||    ||||||||| |||| |   ||    |||||  |||   C   UGG AUCAGGUUAGUAACU   G AAUUAUAAAAGA                 UAGUUUUAA    AUGGUAGUU UAUA G   GA    AGUAU  UUA   U UU   G               AUA A            -----------------         ----         A    G UUC  ---U     GG   AAA |
Stem-loop sequence | AUUGUAGUCCAAUCAUUGACACCAUUAGUAUUUUUUUUUUUUUUUUUUUUGGGGUCAAAAUUUGCAUACUAUCAGAUAUGCUUACUUAGUUCAUAAUGAUGCUUCUAAAAUUGGUAUGAUAGCUUGGAUAUAUUGAUGGUAAAUUUUGAUAGAAAAUAUUAAAGAUAUCAAUGAUUGGACUAGGGUUU |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
XM_017757109.1 |
|
2.0 | PREDICTED: Gossypium arboreum mediator of RNA polymerase II transcription subunit 33B-like (LOC108457903), mRNA | mediator of RNA polymerase II transcription subunit 33B-like(LOC108457903) | coding protein | psRNATarget | |||||||||
XM_017771013.1 |
|
2.0 | PREDICTED: Gossypium arboreum mediator of RNA polymerase II transcription subunit 33B-like (LOC108469904), mRNA | mediator of RNA polymerase II transcription subunit 33B-like(LOC108469904) | coding protein | psRNATarget | |||||||||
XM_017784884.1 |
|
3.0 | PREDICTED: Gossypium arboreum uncharacterized LOC108481805 (LOC108481805), mRNA | uncharacterized LOC108481805(LOC108481805) | coding protein | psRNATarget |