Search result

BaseInfo

ncRNA ID	ath-miRf11101-npr
Species	Arabidopsis thaliana
Class	miRNA
Genome position	NA
Reference genome	NA
Source	PNRD
Length	21
Mature sequence(if miRNA)	NA - UCCUCUGUAUCUUCGUUGUCA - NA
Stem-loop(if miRNA)	A  C     A                   G   G    U  CU U    --   -U  GU CUUGAUUUG UC UCUGU UCUUCGUUGUCAUCACAAA UUC UUAA CU  A UAUC  AAG  CC  U ||||||||| || ||||| ||||||||||||||||||| ||| |||| ||  | ||||  |||  || GAGCUAGAC AG AGAUA AGAAGUAGCAGUAGUGUUU AAG AGUU GA  U AUAG  UUC  GG  G          G  A     C                   A   A    U  AU U    AA   CU  AA
Stem-loop sequence	CUUGAUUUGAUCCUCUGUAUCUUCGUUGUCAUCACAAAGUUCGUUAAUCUCUAUUAUCAAGUCCGUUGAAGGUCCUUAAGAUAUUUAAGUUUGAAGAAAUUUGUGAUGACGAUGAAGACAUAGAAGAGCAGAUCGAG

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
NM_125871.5	ncRNA:21   ACUGUUGCUUCUAUGUCUCCU   1   ***|==||||||||||||||| targets:771   CCUCGGCGAAGAUACAGAGGA   791 Target Full Sequence	3.0	Arabidopsis thaliana Integrase-type DNA-binding superfamily protein (ABR1), mRNA	Integrase-type DNA-binding superfamily protein(ABR1)	coding protein	psRNATarget
AY140092.1	ncRNA:21   ACUGUUGCUUCUAUGUCUCCU   1   ***|==||||||||||||||| targets:681   CCUCGGCGAAGAUACAGAGGA   701 Target Full Sequence	3.0	Arabidopsis thaliana putative protein (At5g64750) mRNA, complete cds	NA	coding protein	psRNATarget
BX832425.1	ncRNA:21   ACUGUUGCUUCUAUGUCUCCU   1   ***|==||||||||||||||| targets:714   CCUCGGCGAAGAUACAGAGGA   734 Target Full Sequence	3.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH71ZH09 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BX830880.1	ncRNA:21   ACUGUUGCUUCUAUGUCUCCU   1   ***|==||||||||||||||| targets:675   CCUCGGCGAAGAUACAGAGGA   695 Target Full Sequence	3.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS35ZF08 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BX832533.1	ncRNA:21   ACUGUUGCUUCUAUGUCUCCU   1   ***|==||||||||||||||| targets:679   CCUCGGCGAAGAUACAGAGGA   699 Target Full Sequence	3.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH79ZE09 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BT008480.1	ncRNA:21   ACUGUUGCUUCUAUGUCUCCU   1   ***|==||||||||||||||| targets:541   CCUCGGCGAAGAUACAGAGGA   561 Target Full Sequence	3.0	Arabidopsis thaliana At5g64750 gene, complete cds	NA	coding protein	psRNATarget