Search result

BaseInfo

ncRNA ID ath-miR398a-5p
Species Arabidopsis thaliana
Class miRNA
Genome position chr2:1040938-1041042 [+]
Reference genome TAIR10
Source miRBase
Length 21
Mature sequence(if miRNA) 11 - AAGGAGUGGCAUGUGAACACA - 31
Stem-loop(if miRNA) UGAAAU        A     A  U       --UA  CU        UUCAAA
      UUCAAAGG GUGGC UG GAACACA    UC  AUGGUUUC      U
      |||||||| ||||| || |||||||    ||  ||||||||
      AAGUUUCC CACUG AC CUUGUGU    AG  UACCAAAG      U
CCCUCU        C     G  U       UUUG  -U        UUACCU
Stem-loop sequence UGAAAUUUCAAAGGAGUGGCAUGUGAACACAUAUCCUAUGGUUUCUUCAAAUUUCCAUUGAAACCAUUGAGUUUUGUGUUCUCAGGUCACCCCUUUGAAUCUCCC

Reference

1 PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA";
Jones-Rhoades MW, Bartel DP;
Mol Cell. 14:787-799(2004).
2 PMID:15258262
"Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis";
Sunkar R, Zhu JK;
Plant Cell. 16:2001-2019(2004).
3 PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant";
Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC;
Genome Res. 16:1276-1288(2006).
4 PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana";
Rajagopalan R, Vaucheret H, Trejo J, Bartel DP;
Genes Dev. 20:3407-3425(2006).
5 PMID:24119003
"Integrated RNA-seq and sRNA-seq analysis identifies novel nitrate-responsive genes in Arabidopsis thaliana roots";
Vidal EA, Moyano TC, Krouk G, Katari MS, Tanurdzic M, McCombie WR, Coruzzi GM, Gutierrez RA;
BMC Genomics. 14:701(2013).