ncRNA ID | ath-miR398a-3p |
Species | Arabidopsis thaliana |
Class | miRNA |
Genome position | chr2:1040938-1041042 [+] |
Reference genome | TAIR10 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 75 - UGUGUUCUCAGGUCACCCCUU - 95 |
Stem-loop(if miRNA) |
UGAAAU        A     A  U       --UA  CU        UUCAAA       UUCAAAGG GUGGC UG GAACACA    UC  AUGGUUUC      U       |||||||| ||||| || |||||||    ||  ||||||||       AAGUUUCC CACUG AC CUUGUGU    AG  UACCAAAG      U CCCUCU        C     G  U       UUUG  -U        UUACCU |
Stem-loop sequence | UGAAAUUUCAAAGGAGUGGCAUGUGAACACAUAUCCUAUGGUUUCUUCAAAUUUCCAUUGAAACCAUUGAGUUUUGUGUUCUCAGGUCACCCCUUUGAAUCUCCC |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
NM_121459.5 |
|
0.0 | Arabidopsis thaliana Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein mRNA | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein(AT5G14550) | coding protein | psRNATarget |
1 | PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"; Jones-Rhoades MW, Bartel DP; Mol Cell. 14:787-799(2004). |
2 | PMID:15258262
"Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis"; Sunkar R, Zhu JK; Plant Cell. 16:2001-2019(2004). |
3 | PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"; Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC; Genome Res. 16:1276-1288(2006). |
4 | PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"; Rajagopalan R, Vaucheret H, Trejo J, Bartel DP; Genes Dev. 20:3407-3425(2006). |
5 | PMID:24119003
"Integrated RNA-seq and sRNA-seq analysis identifies novel nitrate-responsive genes in Arabidopsis thaliana roots"; Vidal EA, Moyano TC, Krouk G, Katari MS, Tanurdzic M, McCombie WR, Coruzzi GM, Gutierrez RA; BMC Genomics. 14:701(2013). |