Search result

BaseInfo

ncRNA ID	ath-miRf10994-npr
Species	Arabidopsis thaliana
Class	miRNA
Genome position	NA
Reference genome	NA
Source	PNRD
Length	20
Mature sequence(if miRNA)	NA - UCCUGCACCGCUCGAUCCGC - NA
Stem-loop(if miRNA)	---   C  G     C            ---    A CCGCU   UGU CU CACCG UCGAUCCGCUGU   CACC U |||||   ||| || ||||| ||||||||||||   |||| GGCGA   ACA GA GUGGC AGUUAGGCGACA   GUGG U      AAU   A  A     A            UCC    C
Stem-loop sequence	CCGCUUGUCCUGCACCGCUCGAUCCGCUGUCACCAUUCGGUGCCUACAGCGGAUUGAACGGUGAAGAACAUAAAGCGG

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
BT012548.1	ncRNA:20   CGCCUAGCUCGCCACGUCCU   1   *||||||*|||||||||||| targets:944   ACGGAUCAAGCGGUGCAGGA   963 Target Full Sequence	1.5	Arabidopsis thaliana At1g10020 gene, complete cds	NA	coding protein	psRNATarget
BT011247.1	ncRNA:20   CGCCUAGCUCGCCACGUCCU   1   *||||||*|||||||||||| targets:1077   ACGGAUCAAGCGGUGCAGGA   1096 Target Full Sequence	1.5	Arabidopsis thaliana At1g10020 mRNA, complete cds	NA	coding protein	psRNATarget
BX813405.1	ncRNA:20   CGCCUAGCUCGCCACGUCCU   1   *||||||*|||||||||||| targets:1133   ACGGAUCAAGCGGUGCAGGA   1152 Target Full Sequence	1.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB15ZF11 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BX815131.1	ncRNA:20   CGCCUAGCUCGCCACGUCCU   1   *||||||*|||||||||||| targets:1180   ACGGAUCAAGCGGUGCAGGA   1199 Target Full Sequence	1.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS36ZG06 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BX815513.1	ncRNA:20   CGCCUAGCUCGCCACGUCCU   1   *||||||*|||||||||||| targets:1147   ACGGAUCAAGCGGUGCAGGA   1166 Target Full Sequence	1.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS69ZC11 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BX813941.1	ncRNA:20   CGCCUAGCUCGCCACGUCCU   1   *||||||*|||||||||||| targets:1176   ACGGAUCAAGCGGUGCAGGA   1195 Target Full Sequence	1.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB49ZC04 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AK229103.1	ncRNA:20   CGCCUAGCUCGCCACGUCCU   1   *||||||*|||||||||||| targets:1177   ACGGAUCAAGCGGUGCAGGA   1196 Target Full Sequence	1.5	Arabidopsis thaliana mRNA for hypothetical protein, complete cds, clone: RAFL16-38-J16	NA	coding protein	psRNATarget
NM_100876.4	ncRNA:20   CGCCUAGCUCGCCACGUCCU   1   *||||||*|||||||||||| targets:1322   ACGGAUCAAGCGGUGCAGGA   1341 Target Full Sequence	1.5	Arabidopsis thaliana formin-like protein (DUF1005) mRNA	formin-like protein (DUF1005)(AT1G10020)	coding protein	psRNATarget