Search result

BaseInfo

ncRNA ID	ath-miRf10982-npr
Species	Arabidopsis thaliana
Class	miRNA
Genome position	NA
Reference genome	NA
Source	PNRD
Length	23
Mature sequence(if miRNA)	NA - GCUGGAGGAACUGCAGCUAUGUA - NA
Stem-loop(if miRNA)	-  -AU       GA  AA            -A       AGU CA   GUUGCUG  GG  CUGCAGCUAUGU  UGAUGGU ||| ||   |||||||  ||  ||||||||||||  ||||||G UCA GU   CGACGAC  CC  GGCGUCGAUGUA  ACUAUCG    U  ACU       UA  -C            AG
Stem-loop sequence	AGUCAAUGUUGCUGGAGGAACUGCAGCUAUGUAUGAUGGUGGCUAUCAGAAUGUAGCUGCGGCCCAUCAGCAGCUCAUGUACU

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
BT024895.1	ncRNA:23   AUGUAUCGACGUCAAGGAGGUCG   1   |||||||||*|||*||||||||| targets:478   UACAUAGCUCCAGAUCCUCCAGC   500 Target Full Sequence	2.5	Arabidopsis thaliana At5g59540 mRNA, complete cds	NA	coding protein	psRNATarget
BX831450.1	ncRNA:23   AUGUAUCGACGUCAAGGAGGUCG   1   |||||||||*|||*||||||||| targets:475   UACAUAGCUCCAGAUCCUCCAGC   497 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS92ZA05 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BX829968.1	ncRNA:23   AUGUAUCGACGUCAAGGAGGUCG   1   |||||||||*|||*||||||||| targets:466   UACAUAGCUCCAGAUCCUCCAGC   488 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB4ZG02 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AK226221.1	ncRNA:23   AUGUAUCGACGUCAAGGAGGUCG   1   |||||||||*|||*||||||||| targets:493   UACAUAGCUCCAGAUCCUCCAGC   515 Target Full Sequence	2.5	Arabidopsis thaliana mRNA for 1-aminocyclopropane-1-carboxylate oxidase - like protein, complete cds, clone: RAFL04-16-B10	NA	coding protein	psRNATarget
AF424616.1	ncRNA:23   AUGUAUCGACGUCAAGGAGGUCG   1   |||||||||*|||*||||||||| targets:487   UACAUAGCUCCAGAUCCUCCAGC   509 Target Full Sequence	2.5	Arabidopsis thaliana AT5g59540/f2o15_200 mRNA, complete cds	NA	coding protein	psRNATarget
NM_001037027.1	ncRNA:23   AUGUAUCGACGUCAAGGAGGUCG   1   |||||||||*|||*||||||||| targets:492   UACAUAGCUCCAGAUCCUCCAGC   514 Target Full Sequence	2.5	Arabidopsis thaliana 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein mRNA	2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein(AT5G59540)	coding protein	psRNATarget
NM_125346.3	ncRNA:23   AUGUAUCGACGUCAAGGAGGUCG   1   |||||||||*|||*||||||||| targets:723   UACAUAGCUCCAGAUCCUCCAGC   745 Target Full Sequence	2.5	Arabidopsis thaliana 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein mRNA	2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein(AT5G59540)	coding protein	psRNATarget