ncRNA ID | ath-miR394b-5p |
Species | Arabidopsis thaliana |
Class | miRNA |
Genome position | chr1:28568808-28568928 [+] |
Reference genome | TAIR10 |
Source | miRBase |
Length | 20 |
Mature sequence(if miRNA) | 14 - UUGGCAUUCUGUCCACCUCC - 33 |
Stem-loop(if miRNA) |
  U     GA   -      U C             UCUC     UUAUGUGUAAUAAGUG CU ACAGA  UCU UUGGCA U UGUCCACCUCCUC    UAUAU                U || |||||  ||| |||||| | |||||||||||||    |||||                A GA UGUCU  AGA AACCGU A ACGGGUGGAGGAG    AUGCU                C   U     AG   U      C U             ---A     UUGUGUGGCAUCUAUG |
Stem-loop sequence | CUUACAGAGAUCUUUGGCAUUCUGUCCACCUCCUCUCUCUAUAUUUAUGUGUAAUAAGUGUACGUAUCUACGGUGUGUUUCGUAAGAGGAGGUGGGCAUACUGCCAAUAGAGAUCUGUUAG |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
BT025325.1 |
|
1.0 | Arabidopsis thaliana At1g27340 mRNA, complete cds | NA | coding protein | psRNATarget | |||||||||
AY085471.1 |
|
1.0 | Arabidopsis thaliana clone 153013 mRNA, complete sequence | NA | coding protein | psRNATarget | |||||||||
BX815904.1 |
|
1.0 | Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH16ZB06 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) | NA | coding protein | psRNATarget | |||||||||
BX816952.1 |
|
1.0 | Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH78ZD04 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) | NA | coding protein | psRNATarget | |||||||||
NM_102496.4 |
|
1.0 | Arabidopsis thaliana Galactose oxidase/kelch repeat superfamily protein (LCR), mRNA | Galactose oxidase/kelch repeat superfamily protein(LCR) | coding protein | psRNATarget |
1 | PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"; Jones-Rhoades MW, Bartel DP; Mol Cell. 14:787-799(2004). |
2 | PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"; Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC; Genome Res. 16:1276-1288(2006). |
3 | PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"; Rajagopalan R, Vaucheret H, Trejo J, Bartel DP; Genes Dev. 20:3407-3425(2006). |