Search result

BaseInfo

ncRNA ID	ath-miRf10935-npr
Species	Arabidopsis thaliana
Class	miRNA
Genome position	NA
Reference genome	NA
Source	PNRD
Length	20
Mature sequence(if miRNA)	NA - ACGUCGCAUAUUUGCGAGGG - NA
Stem-loop(if miRNA)	AGA       U            --G   CG UCGCAA   CGUCGCA AUUUGCGAGGGA   UUG  A ||||||   ||||||| ||||||||||||   |||  G AGCGUU   GCAGCGU UAGACGUUCCCU   GAC  U       CAC       -            AAA   AG
Stem-loop sequence	UCGCAAAGACGUCGCAUAUUUGCGAGGGAGUUGCGAGUGACAGAAAUCCCUUGCAGAUUGCGACGCACUUGCGA

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
NM_113908.1	ncRNA:20   GGGAGCGUUUAUACGCUGCA   1   |||||||||||*|||||||| targets:796   CCCUCGCAAAUUUGCGACGU   815 Target Full Sequence	1.5	Arabidopsis thaliana hypothetical protein partial mRNA	hypothetical protein(AT3G29796)	coding protein	psRNATarget
NM_113908.1	ncRNA:20   GGGAGCGUUUAUACGCUGCA   1   |||||||||||*|||||||| targets:1077   CCCUCGCAAAUUUGCGACGU   1096 Target Full Sequence	1.5	Arabidopsis thaliana hypothetical protein partial mRNA	hypothetical protein(AT3G29796)	coding protein	psRNATarget
BT000642.1	ncRNA:20   GGGAGCGUUUAUACGCUGCA   1   *==|*||||||||||||||| targets:1416   GUUUAGCAAAUAUGCGACGU   1435 Target Full Sequence	3.0	Arabidopsis thaliana At2g29670/T27A16.23 mRNA, complete cds	NA	coding protein	psRNATarget
AY096656.1	ncRNA:20   GGGAGCGUUUAUACGCUGCA   1   *==|*||||||||||||||| targets:1416   GUUUAGCAAAUAUGCGACGU   1435 Target Full Sequence	3.0	Arabidopsis thaliana unknown protein (At2g29670) mRNA, complete cds	NA	coding protein	psRNATarget
AF375460.1	ncRNA:20   GGGAGCGUUUAUACGCUGCA   1   *==|*||||||||||||||| targets:1603   GUUUAGCAAAUAUGCGACGU   1622 Target Full Sequence	3.0	Arabidopsis thaliana At2g29670/T27A16.23 mRNA, complete cds	NA	coding protein	psRNATarget
BX820012.1	ncRNA:20   GGGAGCGUUUAUACGCUGCA   1   *==|*||||||||||||||| targets:1595   GUUUAGCAAAUAUGCGACGU   1614 Target Full Sequence	3.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS5ZH07 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AK119028.1	ncRNA:20   GGGAGCGUUUAUACGCUGCA   1   *==|*||||||||||||||| targets:1600   GUUUAGCAAAUAUGCGACGU   1619 Target Full Sequence	3.0	Arabidopsis thaliana At2g29670 mRNA for unknown protein, complete cds, clone: RAFL21-34-O22	NA	coding protein	psRNATarget
AY074336.1	ncRNA:20   GGGAGCGUUUAUACGCUGCA   1   *==|*||||||||||||||| targets:1604   GUUUAGCAAAUAUGCGACGU   1623 Target Full Sequence	3.0	Arabidopsis thaliana unknown protein (At2g29670) mRNA, complete cds	NA	coding protein	psRNATarget
NM_128521.5	ncRNA:20   GGGAGCGUUUAUACGCUGCA   1   *==|*||||||||||||||| targets:1667   GUUUAGCAAAUAUGCGACGU   1686 Target Full Sequence	3.0	Arabidopsis thaliana Tetratricopeptide repeat (TPR)-like superfamily protein mRNA	Tetratricopeptide repeat (TPR)-like superfamily protein(AT2G29670)	coding protein	psRNATarget
NM_001336221.1	ncRNA:20   GGGAGCGUUUAUACGCUGCA   1   *==|*||||||||||||||| targets:1816   GUUUAGCAAAUAUGCGACGU   1835 Target Full Sequence	3.0	Arabidopsis thaliana Tetratricopeptide repeat (TPR)-like superfamily protein mRNA	Tetratricopeptide repeat (TPR)-like superfamily protein(AT2G29670)	coding protein	psRNATarget