Search result

BaseInfo

ncRNA ID	ath-miRf10928-npr
Species	Arabidopsis thaliana
Class	miRNA
Genome position	NA
Reference genome	NA
Source	PNRD
Length	20
Mature sequence(if miRNA)	NA - GUUGAGCUCGGCUUAACUGC - NA
Stem-loop(if miRNA)	U   -G           -  GC    CU -C    A  UGC  AGCGUUGAGCU CG  UUAA  G  GAGA U  |||  ||||||||||| ||  ||||  |  |||| U  AUG  UCGUAGCUCGA GU  AGUU  C  CUCU A A   GA           U  -A    UU UA    U
Stem-loop sequence	UUGCGAGCGUUGAGCUCGGCUUAACUGCGAGAAUUAUUCUCAUCUUUUGAAUGUAGCUCGAUGCUAGGUAA

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
EF183178.1	ncRNA:20   CGUCAAUUCGGCUCGAGUUG   1   |||||||||||||||||||| targets:1221   GCAGUUAAGCCGAGCUCAAC   1240 Target Full Sequence	0.0	Arabidopsis thaliana clone asmbl_2021 unknown mRNA sequence	NA	coding protein	psRNATarget
BX830713.1	ncRNA:20   CGUCAAUUCGGCUCGAGUUG   1   ||||||||*||||||||||| targets:209   GCAGUUAAUCCGAGCUCAAC   228 Target Full Sequence	1.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS17ZC03 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
DQ446604.1	ncRNA:20   CGUCAAUUCGGCUCGAGUUG   1   |||||*||||=||||||||| targets:191   GCAGUCAAGCUGAGCUCAAC   210 Target Full Sequence	2.5	Arabidopsis thaliana clone pENTR221-At2g36450 AP2 domain-containing protein (At2g36450) mRNA, complete cds	NA	coding protein	psRNATarget
AY560867.1	ncRNA:20   CGUCAAUUCGGCUCGAGUUG   1   |||||*||||=||||||||| targets:191   GCAGUCAAGCUGAGCUCAAC   210 Target Full Sequence	2.5	Arabidopsis thaliana putative AP2/EREBP transcription factor (At2g36450) mRNA, complete cds	NA	coding protein	psRNATarget
DQ653045.1	ncRNA:20   CGUCAAUUCGGCUCGAGUUG   1   |||||*||||=||||||||| targets:191   GCAGUCAAGCUGAGCUCAAC   210 Target Full Sequence	2.5	Arabidopsis thaliana clone 0000012250_0000008884 unknown mRNA	NA	coding protein	psRNATarget
NM_129202.1	ncRNA:20   CGUCAAUUCGGCUCGAGUUG   1   |||||*||||=||||||||| targets:191   GCAGUCAAGCUGAGCUCAAC   210 Target Full Sequence	2.5	Arabidopsis thaliana Integrase-type DNA-binding superfamily protein (HRD), partial mRNA	Integrase-type DNA-binding superfamily protein(HRD)	coding protein	psRNATarget