Search result

BaseInfo

ncRNA ID	ath-miRf10921-npr
Species	Arabidopsis thaliana
Class	miRNA
Genome position	NA
Reference genome	NA
Source	PNRD
Length	20
Mature sequence(if miRNA)	NA - GUGACGGUGGGACGAAUGUU - NA
Stem-loop(if miRNA)	-GG      U        G -           G UCG   AUUUAG GACGGUGG A CGAAUGUUUCG G |||   |||||| |||||||| | ||||||||||| AGC   UAAGUU UUGCCACC U GCUUGCGGAGC U    AUA      C        G A           A
Stem-loop sequence	UCGGGAUUUAGUGACGGUGGGACGAAUGUUUCGGGUACGAGGCGUUCGAUGCCACCGUUCUUGAAUAUACGA

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
NM_101777.2	ncRNA:20   UUGUAAGCAGGGUGGCAGUG   1   |||||||||||||||||||| targets:134   AACAUUCGUCCCACCGUCAC   153 Target Full Sequence	0.0	Arabidopsis thaliana alpha/beta-Hydrolases superfamily protein mRNA	alpha/beta-Hydrolases superfamily protein(AT1G19190)	coding protein	psRNATarget
BT029511.1	ncRNA:20   UUGUAAGCAGGGUGGCAGUG   1   |||||||||||||||||||| targets:81   AACAUUCGUCCCACCGUCAC   100 Target Full Sequence	0.0	Arabidopsis thaliana At1g19190 mRNA, complete cds	NA	coding protein	psRNATarget
NM_111908.5	ncRNA:20   UUGUAAGCAGGGUGGCAGUG   1   ||=||||||*|||||||||| targets:353   AAUAUUCGUGCCACCGUCAC   372 Target Full Sequence	2.5	Arabidopsis thaliana Plant invertase/pectin methylesterase inhibitor superfamily mRNA	Plant invertase/pectin methylesterase inhibitor superfamily(AT3G10720)	coding protein	psRNATarget
AY034996.1	ncRNA:20   UUGUAAGCAGGGUGGCAGUG   1   ||=||||||*|||||||||| targets:213   AAUAUUCGUGCCACCGUCAC   232 Target Full Sequence	2.5	Arabidopsis thaliana putative pectinesterase (At3g10720) mRNA, complete cds	NA	coding protein	psRNATarget
BX823988.1	ncRNA:20   UUGUAAGCAGGGUGGCAGUG   1   ||=||||||*|||||||||| targets:188   AAUAUUCGUGCCACCGUCAC   207 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH12ZG04 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BX822292.1	ncRNA:20   UUGUAAGCAGGGUGGCAGUG   1   ||=||||||*|||||||||| targets:186   AAUAUUCGUGCCACCGUCAC   205 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB26ZH10 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget