Search result

BaseInfo

ncRNA ID	ath-miRf10915-npr
Species	Arabidopsis thaliana
Class	miRNA
Genome position	NA
Reference genome	NA
Source	PNRD
Length	21
Mature sequence(if miRNA)	NA - ACCCAAUCUCUACUUCAGUCU - NA
Stem-loop(if miRNA)	A        C        A            C   U GGU UCGGAAAC CAAUCUCU CUUCAGUCUUUC CUU U ||| |||||||| |||||||| |||||||||||| ||| G CCA AGCUUUUG GUUGGAGA GAAGUCAGAGAG GAA G    A        A        A            A   A
Stem-loop sequence	GGUAUCGGAAACCCAAUCUCUACUUCAGUCUUUCCCUUUUGGAAAGAGAGAGACUGAAGAAGAGGUUGAGUUUUCGAAACC

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
BT000935.1	ncRNA:21   UCUGACUUCAUCUCUAACCCA   1   ||||||=||*||||||||||| targets:758   AGACUGGAGAAGAGAUUGGGU   778 Target Full Sequence	2.5	Arabidopsis thaliana clone C105255 unknown protein (At1g15470) mRNA, complete cds	NA	coding protein	psRNATarget
BX816861.1	ncRNA:21   UCUGACUUCAUCUCUAACCCA   1   ||||||=||*||||||||||| targets:899   AGACUGGAGAAGAGAUUGGGU   919 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH72ZD02 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BX816395.1	ncRNA:21   UCUGACUUCAUCUCUAACCCA   1   ||||||=||*||||||||||| targets:976   AGACUGGAGAAGAGAUUGGGU   996 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH45ZD04 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BX813682.1	ncRNA:21   UCUGACUUCAUCUCUAACCCA   1   ||||||=||*||||||||||| targets:999   AGACUGGAGAAGAGAUUGGGU   1019 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB32ZB12 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BX814278.1	ncRNA:21   UCUGACUUCAUCUCUAACCCA   1   ||||||=||*||||||||||| targets:956   AGACUGGAGAAGAGAUUGGGU   976 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB65ZH04 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BX817070.1	ncRNA:21   UCUGACUUCAUCUCUAACCCA   1   ||||||=||*||||||||||| targets:989   AGACUGGAGAAGAGAUUGGGU   1009 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH83ZH03 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BX816692.1	ncRNA:21   UCUGACUUCAUCUCUAACCCA   1   ||||||=||*||||||||||| targets:997   AGACUGGAGAAGAGAUUGGGU   1017 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH63ZB12 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AY074392.1	ncRNA:21   UCUGACUUCAUCUCUAACCCA   1   ||||||=||*||||||||||| targets:975   AGACUGGAGAAGAGAUUGGGU   995 Target Full Sequence	2.5	Arabidopsis thaliana At1g15470 mRNA sequence	NA	coding protein	psRNATarget
AY084604.1	ncRNA:21   UCUGACUUCAUCUCUAACCCA   1   ||||||=||*||||||||||| targets:1005   AGACUGGAGAAGAGAUUGGGU   1025 Target Full Sequence	2.5	Arabidopsis thaliana clone 113014 mRNA, complete sequence	NA	coding protein	psRNATarget
NM_101416.3	ncRNA:21   UCUGACUUCAUCUCUAACCCA   1   ||||||=||*||||||||||| targets:1005   AGACUGGAGAAGAGAUUGGGU   1025 Target Full Sequence	2.5	Arabidopsis thaliana Transducin/WD40 repeat-like superfamily protein mRNA	Transducin/WD40 repeat-like superfamily protein(AT1G15470)	coding protein	psRNATarget
BX813912.1	ncRNA:21   UCUGACUUCAUCUCUAACCCA   1   |*||||=||*||||||||||| targets:991   AUACUGGAGAAGAGAUUGGGU   1011 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB47ZC06 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BX814506.1	ncRNA:21   UCUGACUUCAUCUCUAACCCA   1   |*||||=||*||||||||||| targets:994   AAACUGGAGAAGAGAUUGGGU   1014 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB77ZF09 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BX828109.1	ncRNA:21   UCUGACUUCAUCUCUAACCCA   1   ***||||||||||||*||||| targets:736   CAUCUGAAGUAGAGAAUGGGU   756 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH53ZB09 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget