ncRNA ID | ath-miRf10913-npr |
Species | Arabidopsis thaliana |
Class | miRNA |
Genome position | NA |
Reference genome | NA |
Source | PNRD |
Length | 20 |
Mature sequence(if miRNA) | NA - AUGAUGCGCAAAUGCGGAUA - NA |
Stem-loop(if miRNA) |
GUAU  A                     C  U   A    G   AA   ACCAAUA  GGU    AGCGAAA   AC     GA AUGAUGCGCAAAUGCGGAUAU AA GUA AUCA GAC  CAA       GA   GCUC       ACA  A     || ||||||||||||||||||||| || ||| |||| |||  |||       ||   ||||       |||     CU UACUACGCGUUUACGCCUAUA UU CAU UAGU CUG  GUU       CU   UGGG       UGU  A CAGU  C                     U  C   A    A   GG   ACAAAGA  AUU    --AAAAG   AA |
Stem-loop sequence | GUAUGAAAUGAUGCGCAAAUGCGGAUAUCAAUGUAAAUCAGGACAACAAACCAAUAGAGGUGCUCAGCGAAAACAACAAAAUGUGAAAAGGGUUUAUCAGAAACAUUGGGGUCAUGAUAUACCUUUAUAUCCGCAUUUGCGCAUCAUCUCUGAC |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
BT010457.1 |
|
2.5 | Arabidopsis thaliana ribonuclease II-related protein (At5g02250) mRNA, complete cds | NA | coding protein | psRNATarget | |||||||||
BX832316.1 |
|
2.5 | Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH64ZH07 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) | NA | coding protein | psRNATarget | |||||||||
AK176383.1 |
|
2.5 | Arabidopsis thaliana mRNA for ribonuclease II-like protein, complete cds, clone: RAFL24-09-I17 | NA | coding protein | psRNATarget | |||||||||
NM_120303.5 |
|
2.5 | Arabidopsis thaliana Ribonuclease II/R family protein (EMB2730), mRNA | Ribonuclease II/R family protein(EMB2730) | coding protein | psRNATarget |