Search result

BaseInfo

ncRNA ID	ath-miR395e
Species	Arabidopsis thaliana
Class	miRNA
Genome position	chr1:26272776-26272870 [-]
Reference genome	TAIR10
Source	miRBase
Length	21
Mature sequence(if miRNA)	11 - CUGAAGUGUUUGGGGGAACUC - 31
Stem-loop(if miRNA)	AUGUUU   -A         UG         U      U  A     U       UCU  GAGUUCCUC  AGCACUUCA UGGAGA AC AUUUU U       |||  |||||||||  ||||||||| |||||| || |||||       GGG  CUCAAGGGG  UUGUGAAGU AUCUUU UG UAAAA A -UAGUC   CC         GU         C      -  A     U
Stem-loop sequence	AUGUUUUCUAGAGUUCCUCUGAGCACUUCAUUGGAGAUACAAUUUUUUAUAAAAUAGUUUUCUACUGAAGUGUUUGGGGGAACUCCCGGGCUGAU

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
AY117323.1	ncRNA:21   CUCAAGGGGGUUUGUGAAGUC   1   |||||||=||||||||||||* targets:340   GAGUUCCUCCAAACACUUCAU   360 Target Full Sequence	2.0	Arabidopsis thaliana putative ATP sulfurylase precursor (At5g43780) mRNA, complete cds	NA	coding protein	psRNATarget
BX830658.1	ncRNA:21   CUCAAGGGGGUUUGUGAAGUC   1   |||||||=||||||||||||* targets:339   GAGUUCCUCCAAACACUUCAU   359 Target Full Sequence	2.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS10ZH07 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AY072193.1	ncRNA:21   CUCAAGGGGGUUUGUGAAGUC   1   |||||||=||||||||||||* targets:352   GAGUUCCUCCAAACACUUCAU   372 Target Full Sequence	2.0	Arabidopsis thaliana putative ATP sulfurylase precursor (At5g43780) mRNA, complete cds	NA	coding protein	psRNATarget
AK226204.1	ncRNA:21   CUCAAGGGGGUUUGUGAAGUC   1   |||||||=||||||||||||* targets:353   GAGUUCCUCCAAACACUUCAU   373 Target Full Sequence	2.0	Arabidopsis thaliana mRNA for ATP sulfurylase precursor, complete cds, clone: RAFL04-13-C05	NA	coding protein	psRNATarget
BX830619.1	ncRNA:21   CUCAAGGGGGUUUGUGAAGUC   1   |||||||=||||||||||||* targets:396   GAGUUCCUCCAAACACUUCAU   416 Target Full Sequence	2.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB94ZC06 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AJ012586.1	ncRNA:21   CUCAAGGGGGUUUGUGAAGUC   1   |||||||=||||||||||||* targets:368   GAGUUCCUCCAAACACUUCAU   388 Target Full Sequence	2.0	Arabidopsis thaliana mRNA for sulfate adenylyltransferase	NA	coding protein	psRNATarget
NM_123745.6	ncRNA:21   CUCAAGGGGGUUUGUGAAGUC   1   |||||||=||||||||||||* targets:597   GAGUUCCUCCAAACACUUCAU   617 Target Full Sequence	2.0	Arabidopsis thaliana Pseudouridine synthase/archaeosine transglycosylase-like family protein (APS4), mRNA	Pseudouridine synthase/archaeosine transglycosylase-like family protein(APS4)	coding protein	psRNATarget
BT008605.1	ncRNA:21   CUCAAGGGGGUUUGUGAAGUC   1   ||||*||=||||||||||||| targets:979   GAGUGCCUCCAAACACUUCAG   999 Target Full Sequence	2.0	Arabidopsis thaliana clone U20917 unknown protein (At2g28780) mRNA, complete cds	NA	coding protein	psRNATarget
BT004090.1	ncRNA:21   CUCAAGGGGGUUUGUGAAGUC   1   ||||*||=||||||||||||| targets:1119   GAGUGCCUCCAAACACUUCAG   1139 Target Full Sequence	2.0	Arabidopsis thaliana clone RAFL16-01-M05 (R20917) unknown protein (At2g28780) mRNA, complete cds	NA	coding protein	psRNATarget
NM_128437.3	ncRNA:21   CUCAAGGGGGUUUGUGAAGUC   1   ||||*||=||||||||||||| targets:1141   GAGUGCCUCCAAACACUUCAG   1161 Target Full Sequence	2.0	Arabidopsis thaliana P-hydroxybenzoic acid efflux pump subunit mRNA	P-hydroxybenzoic acid efflux pump subunit(AT2G28780)	coding protein	psRNATarget
AY093335.1	ncRNA:21   CUCAAGGGGGUUUGUGAAGUC   1   *|||||=|||||||||||||* targets:44   AAGUUCUCCCAAACACUUCAA   64 Target Full Sequence	2.0	Arabidopsis thaliana sulfate transporter (At5g10180) mRNA, complete cds	NA	coding protein	psRNATarget
BX832587.1	ncRNA:21   CUCAAGGGGGUUUGUGAAGUC   1   *|||||=|||||||||||||* targets:115   AAGUUCUCCCAAACACUUCAA   135 Target Full Sequence	2.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH82ZE06 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AY062546.1	ncRNA:21   CUCAAGGGGGUUUGUGAAGUC   1   *|||||=|||||||||||||* targets:125   AAGUUCUCCCAAACACUUCAA   145 Target Full Sequence	2.0	Arabidopsis thaliana sulfate transporter (At5g10180; T31P16_170) mRNA, complete cds	NA	coding protein	psRNATarget
AB003591.1	ncRNA:21   CUCAAGGGGGUUUGUGAAGUC   1   *|||||=|||||||||||||* targets:111   AAGUUCUCCCAAACACUUCAA   131 Target Full Sequence	2.0	Arabidopsis thaliana mRNA for sulfate transporter, complete cds	NA	coding protein	psRNATarget
NM_121056.3	ncRNA:21   CUCAAGGGGGUUUGUGAAGUC   1   *|||||=|||||||||||||* targets:252   AAGUUCUCCCAAACACUUCAA   272 Target Full Sequence	2.0	Arabidopsis thaliana slufate transporter 2;1 (SULTR2;1), mRNA	slufate transporter 2;1(SULTR2;1)	coding protein	psRNATarget
NM_001333459.1	ncRNA:21   CUCAAGGGGGUUUGUGAAGUC   1   ||*|||||||||||||||||* targets:69   GAAUUCCCCCAAACACUUCAA   89 Target Full Sequence	2.0	Arabidopsis thaliana Serine/Threonine-kinase partial mRNA	Serine/Threonine-kinase(AT1G50930)	coding protein	psRNATarget
AY630765.1	ncRNA:21   CUCAAGGGGGUUUGUGAAGUC   1   ||*|||||||||||||||||* targets:42   GAAUUCCCCCAAACACUUCAA   62 Target Full Sequence	2.0	Arabidopsis thaliana hypothetical protein (At1G50930) mRNA, complete cds	NA	coding protein	psRNATarget
NM_103973.3	ncRNA:21   CUCAAGGGGGUUUGUGAAGUC   1   ||*|||||||||||||||||* targets:69   GAAUUCCCCCAAACACUUCAA   89 Target Full Sequence	2.0	Arabidopsis thaliana Serine/Threonine-kinase mRNA	Serine/Threonine-kinase(AT1G50930)	coding protein	psRNATarget

Reference

1	PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"; Jones-Rhoades MW, Bartel DP; Mol Cell. 14:787-799(2004).
2	PMID:16040653 "Expression of Arabidopsis MIRNA genes"; Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC; Plant Physiol. 138:2145-2154(2005).
3	PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"; Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC; Genome Res. 16:1276-1288(2006).
4	PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"; Rajagopalan R, Vaucheret H, Trejo J, Bartel DP; Genes Dev. 20:3407-3425(2006).
5	PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"; Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW; J Exp Bot. 61:165-177(2010).