Search result

BaseInfo

ncRNA ID	ath-miRf10864-npr
Species	Arabidopsis thaliana
Class	miRNA
Genome position	NA
Reference genome	NA
Source	PNRD
Length	20
Mature sequence(if miRNA)	NA - CUCGCAAAUCCCUCGCAGAA - NA
Stem-loop(if miRNA)	--          C           --AA  CG AA   C CAACG  CCUCGCAAAU CCUCGCAGAAG    GU  C  AAU C |||||  |||||||||| |||||||||||    ||  |  ||| GUUGC  GGAGUGUUUA GGAGCGUUUUC    CA  G  UUA U      UG          A           AUCC  AU AG   A
Stem-loop sequence	CAACGCCUCGCAAAUCCCUCGCAGAAGAAGUCGCAAAAUCCUAAUUGAGUAACCCUACUUUUGCGAGGAAUUUGUGAGGGUCGUUG

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
AK230032.1	ncRNA:20   AAGACGCUCCCUAAACGCUC   1   *|=|||||||||*||||||| targets:1394   GUUUGCGAGGGACUUGCGAG   1413 Target Full Sequence	2.5	Arabidopsis thaliana mRNA for hypothetical protein, complete cds, clone: RAFL22-57-N05	NA	coding protein	psRNATarget
AF036301.1	ncRNA:20   AAGACGCUCCCUAAACGCUC   1   |*||||||||||||||*||| targets:739   UCCUGCGAGGGAUUUGAGAG   758 Target Full Sequence	2.5	Arabidopsis thaliana scarecrow-like 3 (SCL3) mRNA, partial cds	NA	coding protein	psRNATarget
AY091260.1	ncRNA:20   AAGACGCUCCCUAAACGCUC   1   |*||||||||||||||*||| targets:1210   UCCUGCGAGGGAUUUGAGAG   1229 Target Full Sequence	2.5	Arabidopsis thaliana putative scarecrow 3 protein (At1g50420) mRNA, complete cds	NA	coding protein	psRNATarget
BX816229.1	ncRNA:20   AAGACGCUCCCUAAACGCUC   1   |*||||||||||||||*||| targets:1226   UCCUGCGAGGGAUUUGAGAG   1245 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH35ZH10 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BX814832.1	ncRNA:20   AAGACGCUCCCUAAACGCUC   1   |*||||||||||||||*||| targets:1405   UCCUGCGAGGGAUUUGAGAG   1424 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS10ZB03 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AY056154.1	ncRNA:20   AAGACGCUCCCUAAACGCUC   1   |*||||||||||||||*||| targets:1409   UCCUGCGAGGGAUUUGAGAG   1428 Target Full Sequence	2.5	Arabidopsis thaliana putative scarecrow 3 protein (At1g50420) mRNA, complete cds	NA	coding protein	psRNATarget
BX815261.1	ncRNA:20   AAGACGCUCCCUAAACGCUC   1   |*||||||||||||||*||| targets:1397   UCCUGCGAGGGAUUUGAGAG   1416 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS47ZD05 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
NM_103925.6	ncRNA:20   AAGACGCUCCCUAAACGCUC   1   |*||||||||||||||*||| targets:1644   UCCUGCGAGGGAUUUGAGAG   1663 Target Full Sequence	2.5	Arabidopsis thaliana scarecrow-like 3 (SCL3), mRNA	scarecrow-like 3(SCL3)	coding protein	psRNATarget