Search result

BaseInfo

ncRNA ID	ath-miRf10846-npr
Species	Arabidopsis thaliana
Class	miRNA
Genome position	NA
Reference genome	NA
Source	PNRD
Length	25
Mature sequence(if miRNA)	NA - UGAAUACGACCCACUAGAAAUUGAA - NA
Stem-loop(if miRNA)	A           C     A          U            UUCAUUUUUUG        UU GA GAGUUGC UGUGAAUACGA CCACU GAAAUUGAAA AAACAAAGAAAU           UAGUAUAA  U  U ||||||| ||||||||||| ||||| |||||||||| ||||||||||||           ||||||||  | UUCAACG ACACUUAUGCU GGUGA CUUUGACUUU UUUGUUUCUUUG           GUCAUAUU  A  A        A           C     A          C            ------UUAUA        UU AA
Stem-loop sequence	GAGUUGCAUGUGAAUACGACCCACUAGAAAUUGAAAUAAACAAAGAAAUUUCAUUUUUUGUAGUAUAAUUUGAUAAAAUUUUAUACUGAUAUUGUUUCUUUGUUUCUUUCAGUUUCAAGUGGCUCGUAUUCACAAGCAACUU

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
NM_179968.3	ncRNA:25   AAGUUAAAGAUCACCCAGCAUAAGU   1   ||||=||||*||||||||||||||| targets:354   UUCAGUUUCCAGUGGGUCGUAUUCA   378 Target Full Sequence	1.0	Arabidopsis thaliana histone H2A 8 (HTA8), mRNA	histone H2A 8(HTA8)	coding protein	psRNATarget
BX821662.1	ncRNA:25   AAGUUAAAGAUCACCCAGCAUAAGU   1   ||||=||||*||||||||||||||| targets:235   UUCAGUUUCCAGUGGGUCGUAUUCA   259 Target Full Sequence	1.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL62ZC09 of Silique of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
NM_001336738.1	ncRNA:25   AAGUUAAAGAUCACCCAGCAUAAGU   1   ||||=||||*||||||||||||||| targets:215   UUCAGUUUCCAGUGGGUCGUAUUCA   239 Target Full Sequence	1.0	Arabidopsis thaliana histone H2A 8 (HTA8), mRNA	histone H2A 8(HTA8)	coding protein	psRNATarget
NM_129438.2	ncRNA:25   AAGUUAAAGAUCACCCAGCAUAAGU   1   ||||=||||*||||||||||||||| targets:228   UUCAGUUUCCAGUGGGUCGUAUUCA   252 Target Full Sequence	1.0	Arabidopsis thaliana histone H2A 8 (HTA8), mRNA	histone H2A 8(HTA8)	coding protein	psRNATarget
AY088573.1	ncRNA:25   AAGUUAAAGAUCACCCAGCAUAAGU   1   ||||=||||*||||||||||||||| targets:228   UUCAGUUUCCAGUGGGUCGUAUUCA   252 Target Full Sequence	1.0	Arabidopsis thaliana clone 8 mRNA, complete sequence	NA	coding protein	psRNATarget
NM_179967.2	ncRNA:25   AAGUUAAAGAUCACCCAGCAUAAGU   1   ||||=||||*||||||||||||||| targets:131   UUCAGUUUCCAGUGGGUCGUAUUCA   155 Target Full Sequence	1.0	Arabidopsis thaliana histone H2A 8 (HTA8), mRNA	histone H2A 8(HTA8)	coding protein	psRNATarget
AK220868.1	ncRNA:25   AAGUUAAAGAUCACCCAGCAUAAGU   1   ||||=||||*||||||||||||||| targets:131   UUCAGUUUCCAGUGGGUCGUAUUCA   155 Target Full Sequence	1.0	Arabidopsis thaliana mRNA for histone H2A, complete cds, clone: RAFL22-42-E22	NA	coding protein	psRNATarget
AK228272.1	ncRNA:25   AAGUUAAAGAUCACCCAGCAUAAGU   1   ||||=||||*||||||||||||||| targets:131   UUCAGUUUCCAGUGGGUCGUAUUCA   155 Target Full Sequence	1.0	Arabidopsis thaliana mRNA for histone H2A, complete cds, clone: RAFL14-72-G22	NA	coding protein	psRNATarget
BX821514.1	ncRNA:25   AAGUUAAAGAUCACCCAGCAUAAGU   1   ||||=||||*||||||||||||||| targets:117   UUCAGUUUCCAGUGGGUCGUAUUCA   141 Target Full Sequence	1.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL47ZE12 of Silique of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BX821413.1	ncRNA:25   AAGUUAAAGAUCACCCAGCAUAAGU   1   ||||=||||*||||||||||||||| targets:115   UUCAGUUUCCAGUGGGUCGUAUUCA   139 Target Full Sequence	1.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL3ZE05 of Silique of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BT026423.1	ncRNA:25   AAGUUAAAGAUCACCCAGCAUAAGU   1   ||||=||||*||||||||||||||| targets:110   UUCAGUUUCCAGUGGGUCGUAUUCA   134 Target Full Sequence	1.0	Arabidopsis thaliana At2g38810 mRNA, complete cds	NA	coding protein	psRNATarget
NM_001203788.1	ncRNA:25   AAGUUAAAGAUCACCCAGCAUAAGU   1   ||*=|||||*|||||*||||||||| targets:170   UUAGAUUUCAAGUGGCUCGUAUUCA   194 Target Full Sequence	2.5	Arabidopsis thaliana histone H2A 4 (HTA4), mRNA	histone H2A 4(HTA4)	coding protein	psRNATarget