Search result

BaseInfo

ncRNA ID	ath-miR157a-5p
Species	Arabidopsis thaliana
Class	miRNA
Genome position	chr1:24913202-24913299 [-]
Reference genome	TAIR10
Source	miRBase
Length	21
Mature sequence(if miRNA)	75 - UUGACAGAAGAUAGAGAGCAC - 95
Stem-loop(if miRNA)	-   U         -A             U  -      A   UUC    C  GUG UGACAGAAG  UAGAGAGCACAGA GA UGAGAU CAA   GGAG A  ||| |||||||||  ||||||||||||| || |||||| |||   ||||  CAC ACUGUCUUC  AUCUCUCGUGUUU CU AUUCUA GUU   UCUU U C   U         CG             C  C      C   ---    G
Stem-loop sequence	GUGUUGACAGAAGAUAGAGAGCACAGAUGAUGAGAUACAAUUCGGAGCAUGUUCUUUGCAUCUUACUCCUUUGUGCUCUCUAGCCUUCUGUCAUCACC

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
NM_001332756.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||| targets:2739   GUGCUCUCUCUCUUCUGUCAA   2759 Target Full Sequence	1.5	Arabidopsis thaliana squamosa promoter binding protein-like 10 (SPL10), mRNA	squamosa promoter binding protein-like 10(SPL10)	coding protein	psRNATarget
NM_102499.4	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||| targets:2630   GUGCUCUCUCUCUUCUGUCAA   2650 Target Full Sequence	1.5	Arabidopsis thaliana squamosa promoter binding protein-like 10 (SPL10), mRNA	squamosa promoter binding protein-like 10(SPL10)	coding protein	psRNATarget
NM_001036019.3	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||| targets:2442   GUGCUCUCUCUCUUCUGUCAA   2462 Target Full Sequence	1.5	Arabidopsis thaliana squamosa promoter binding protein-like 10 (SPL10), mRNA	squamosa promoter binding protein-like 10(SPL10)	coding protein	psRNATarget
NM_001332755.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||| targets:2372   GUGCUCUCUCUCUUCUGUCAA   2392 Target Full Sequence	1.5	Arabidopsis thaliana squamosa promoter binding protein-like 10 (SPL10), mRNA	squamosa promoter binding protein-like 10(SPL10)	coding protein	psRNATarget
NM_102498.3	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||| targets:2330   GUGCUCUCUCUCUUCUGUCAA   2350 Target Full Sequence	1.5	Arabidopsis thaliana squamosa promoter-like 11 (SPL11), mRNA	squamosa promoter-like 11(SPL11)	coding protein	psRNATarget
AY074853.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||| targets:2354   GUGCUCUCUCUCUUCUGUCAA   2374 Target Full Sequence	1.5	Arabidopsis thaliana At1g27370/F17L21_16 mRNA, complete cds	NA	coding protein	psRNATarget
NM_001084135.2	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||| targets:2227   GUGCUCUCUCUCUUCUGUCAA   2247 Target Full Sequence	1.5	Arabidopsis thaliana squamosa promoter-like 11 (SPL11), mRNA	squamosa promoter-like 11(SPL11)	coding protein	psRNATarget
NM_001084134.2	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||| targets:2123   GUGCUCUCUCUCUUCUGUCAA   2143 Target Full Sequence	1.5	Arabidopsis thaliana squamosa promoter-like 11 (SPL11), mRNA	squamosa promoter-like 11(SPL11)	coding protein	psRNATarget
NM_180791.3	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||| targets:1891   GUGCUCUCUCUCUUCUGUCAA   1911 Target Full Sequence	1.5	Arabidopsis thaliana squamosa promoter binding protein-like 2 (SPL2), mRNA	squamosa promoter binding protein-like 2(SPL2)	coding protein	psRNATarget
NM_203146.4	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||| targets:1807   GUGCUCUCUCUCUUCUGUCAA   1827 Target Full Sequence	1.5	Arabidopsis thaliana squamosa promoter binding protein-like 2 (SPL2), mRNA	squamosa promoter binding protein-like 2(SPL2)	coding protein	psRNATarget
NM_202192.2	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||| targets:1507   GUGCUCUCUCUCUUCUGUCAA   1527 Target Full Sequence	1.5	Arabidopsis thaliana squamosa promoter binding protein-like 10 (SPL10), mRNA	squamosa promoter binding protein-like 10(SPL10)	coding protein	psRNATarget
NM_129782.3	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||| targets:1175   GUGCUCUCUCUCUUCUGUCAA   1195 Target Full Sequence	1.5	Arabidopsis thaliana squamosa promoter binding protein-like 9 (SPL9), mRNA	squamosa promoter binding protein-like 9(SPL9)	coding protein	psRNATarget
NM_123693.6	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||| targets:1256   GUGCUCUCUCUCUUCUGUCAA   1276 Target Full Sequence	1.5	Arabidopsis thaliana squamosa promoter binding protein-like 2 (SPL2), mRNA	squamosa promoter binding protein-like 2(SPL2)	coding protein	psRNATarget
NM_202191.2	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||| targets:1398   GUGCUCUCUCUCUUCUGUCAA   1418 Target Full Sequence	1.5	Arabidopsis thaliana squamosa promoter-like 11 (SPL11), mRNA	squamosa promoter-like 11(SPL11)	coding protein	psRNATarget
NM_001084136.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||| targets:1315   GUGCUCUCUCUCUUCUGUCAA   1335 Target Full Sequence	1.5	Arabidopsis thaliana squamosa promoter binding protein-like 10 (SPL10), mRNA	squamosa promoter binding protein-like 10(SPL10)	coding protein	psRNATarget
AJ011625.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||| targets:1165   GUGCUCUCUCUCUUCUGUCAA   1185 Target Full Sequence	1.5	Arabidopsis thaliana (ecotype Landsberg erecta) mRNA for squamosa promoter binding protein-like 2	NA	coding protein	psRNATarget
BT004327.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||| targets:1186   GUGCUCUCUCUCUUCUGUCAA   1206 Target Full Sequence	1.5	Arabidopsis thaliana clone RAFL15-31-G21 (R50184) At5g43270 mRNA, complete sequence	NA	coding protein	psRNATarget
BX816068.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||| targets:1296   GUGCUCUCUCUCUUCUGUCAA   1316 Target Full Sequence	1.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH26ZB04 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
NM_001332754.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||| targets:1193   GUGCUCUCUCUCUUCUGUCAA   1213 Target Full Sequence	1.5	Arabidopsis thaliana squamosa promoter binding protein-like 10 (SPL10), mRNA	squamosa promoter binding protein-like 10(SPL10)	coding protein	psRNATarget
BX832034.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||| targets:1352   GUGCUCUCUCUCUUCUGUCAA   1372 Target Full Sequence	1.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH47ZH02 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AY046007.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||| targets:937   GUGCUCUCUCUCUUCUGUCAA   957 Target Full Sequence	1.5	Arabidopsis thaliana putative squamosa-promoter binding protein (At2g42200) mRNA, complete cds	NA	coding protein	psRNATarget
AY070106.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||| targets:1253   GUGCUCUCUCUCUUCUGUCAA   1273 Target Full Sequence	1.5	Arabidopsis thaliana putative squamosa-promoter binding protein 2 (At1g27360) mRNA, complete cds	NA	coding protein	psRNATarget
BX831680.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||| targets:1103   GUGCUCUCUCUCUUCUGUCAA   1123 Target Full Sequence	1.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH23ZD07 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AJ011626.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||| targets:1063   GUGCUCUCUCUCUUCUGUCAA   1083 Target Full Sequence	1.5	Arabidopsis thaliana (ecotype Columbia) mRNA for squamosa promoter binding protein-like 2	NA	coding protein	psRNATarget
AK230160.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||| targets:1149   GUGCUCUCUCUCUUCUGUCAA   1169 Target Full Sequence	1.5	Arabidopsis thaliana mRNA for squamosa promoter binding protein-like 2, complete cds, clone: RAFL22-87-G21	NA	coding protein	psRNATarget
NM_115654.3	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||| targets:845   GUGCUCUCUCUCUUCUGUCAA   865 Target Full Sequence	1.5	Arabidopsis thaliana squamosa promoter binding protein-like 15 (SPL15), mRNA	squamosa promoter binding protein-like 15(SPL15)	coding protein	psRNATarget
BX818496.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||| targets:1178   GUGCUCUCUCUCUUCUGUCAA   1198 Target Full Sequence	1.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL82ZC03 of Silique of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AJ011639.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||| targets:781   GUGCUCUCUCUCUUCUGUCAA   801 Target Full Sequence	1.5	Arabidopsis thaliana (ecotype Landsberg erecta) mRNA for squamosa promoter binding protein-like 9	NA	coding protein	psRNATarget
BX832762.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||| targets:1111   GUGCUCUCUCUCUUCUGUCAA   1131 Target Full Sequence	1.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH9ZD01 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AY088185.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||| targets:1195   GUGCUCUCUCUCUUCUGUCAA   1215 Target Full Sequence	1.5	Arabidopsis thaliana clone 42666 mRNA, complete sequence	NA	coding protein	psRNATarget
BX815562.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||| targets:1212   GUGCUCUCUCUCUUCUGUCAA   1232 Target Full Sequence	1.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS71ZF01 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AY086384.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||| targets:785   GUGCUCUCUCUCUUCUGUCAA   805 Target Full Sequence	1.5	Arabidopsis thaliana clone 247919 mRNA, complete sequence	NA	coding protein	psRNATarget
AJ011637.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||| targets:1122   GUGCUCUCUCUCUUCUGUCAA   1142 Target Full Sequence	1.5	Arabidopsis thaliana (ecotype Columbia) mRNA for squamosa promoter binding protein-like 10	NA	coding protein	psRNATarget
AJ011638.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||| targets:775   GUGCUCUCUCUCUUCUGUCAA   795 Target Full Sequence	1.5	Arabidopsis thaliana (ecotype Columbia) mRNA for squamosa promoter binding protein-like 9	NA	coding protein	psRNATarget
AJ011635.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||| targets:1122   GUGCUCUCUCUCUUCUGUCAA   1142 Target Full Sequence	1.5	Arabidopsis thaliana (ecotype Columbia) mRNA for squamosa promoter binding protein-like 11	NA	coding protein	psRNATarget
BT025984.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||| targets:1010   GUGCUCUCUCUCUUCUGUCAA   1030 Target Full Sequence	1.5	Arabidopsis thaliana At5g43270 mRNA, complete cds	NA	coding protein	psRNATarget
AY091286.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||| targets:1085   GUGCUCUCUCUCUUCUGUCAA   1105 Target Full Sequence	1.5	Arabidopsis thaliana putative squamosa-promoter binding protein 2 (At1g27360) mRNA, complete cds	NA	coding protein	psRNATarget
AY142028.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||| targets:1085   GUGCUCUCUCUCUUCUGUCAA   1105 Target Full Sequence	1.5	Arabidopsis thaliana At1g27370/F17L21_16 mRNA, complete cds	NA	coding protein	psRNATarget
AY150378.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||| targets:743   GUGCUCUCUCUCUUCUGUCAA   763 Target Full Sequence	1.5	Arabidopsis thaliana putative squamosa-promoter binding protein (At2g42200) mRNA, complete cds	NA	coding protein	psRNATarget
AJ628864.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||| targets:743   GUGCUCUCUCUCUUCUGUCAA   763 Target Full Sequence	1.5	Arabidopsis thaliana mRNA for putative squamosa-promoter binding protein (At2g42200 gene)	NA	coding protein	psRNATarget
NM_105584.6	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||= targets:1297   GUGCUCUCUCUCUUCUGUCAG   1317 Target Full Sequence	2.5	Arabidopsis thaliana Squamosa promoter-binding protein-like (SBP domain) transcription factor family protein mRNA	Squamosa promoter-binding protein-like (SBP domain) transcription factor family protein(AT1G69170)	coding protein	psRNATarget
BX815862.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||= targets:1267   GUGCUCUCUCUCUUCUGUCAG   1287 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH13ZC06 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AK227964.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||= targets:1122   GUGCUCUCUCUCUUCUGUCAG   1142 Target Full Sequence	2.5	Arabidopsis thaliana mRNA for squamosa promoter binding protein-like 6, complete cds, clone: RAFL14-51-E10	NA	coding protein	psRNATarget
AJ011643.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||= targets:979   GUGCUCUCUCUCUUCUGUCAG   999 Target Full Sequence	2.5	Arabidopsis thaliana (ecotype Columbia) mRNA for squamosa promoter binding protein-like 6	NA	coding protein	psRNATarget
BT006436.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||= targets:908   GUGCUCUCUCUCUUCUGUCAG   928 Target Full Sequence	2.5	Arabidopsis thaliana At1g69170 gene, complete cds	NA	coding protein	psRNATarget
AF370612.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||= targets:875   GUGCUCUCUCUCUUCUGUCAG   895 Target Full Sequence	2.5	Arabidopsis thaliana similar to squamosa-promoter binding protein 1 isolog gi|1707009 (F4N2.13) mRNA, complete cds	NA	coding protein	psRNATarget
NM_124435.3	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||* targets:1634   GUGCUCUCUCUCUUCUGUCAU   1654 Target Full Sequence	2.5	Arabidopsis thaliana Squamosa promoter-binding protein-like (SBP domain) transcription factor family protein (SPL13A), mRNA	Squamosa promoter-binding protein-like (SBP domain) transcription factor family protein(SPL13A)	coding protein	psRNATarget
NM_180830.4	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||* targets:1264   GUGCUCUCUCUCUUCUGUCAU   1284 Target Full Sequence	2.5	Arabidopsis thaliana Squamosa promoter-binding protein-like (SBP domain) transcription factor family protein (SPL13A), mRNA	Squamosa promoter-binding protein-like (SBP domain) transcription factor family protein(SPL13A)	coding protein	psRNATarget
NM_001344905.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||* targets:1283   GUGCUCUCUCUCUUCUGUCAU   1303 Target Full Sequence	2.5	Arabidopsis thaliana Squamosa promoter-binding protein-like (SBP domain) transcription factor family protein (SPL13B), mRNA	Squamosa promoter-binding protein-like (SBP domain) transcription factor family protein(SPL13B)	coding protein	psRNATarget
NM_124445.4	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||* targets:1264   GUGCUCUCUCUCUUCUGUCAU   1284 Target Full Sequence	2.5	Arabidopsis thaliana Squamosa promoter-binding protein-like (SBP domain) transcription factor family protein (SPL13B), mRNA	Squamosa promoter-binding protein-like (SBP domain) transcription factor family protein(SPL13B)	coding protein	psRNATarget
AK317730.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||* targets:1042   GUGCUCUCUCUCUUCUGUCAU   1062 Target Full Sequence	2.5	Arabidopsis thaliana AT5G50570 mRNA, complete cds, clone: RAFL25-16-N16	NA	coding protein	psRNATarget
AY084609.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||* targets:1025   GUGCUCUCUCUCUUCUGUCAU   1045 Target Full Sequence	2.5	Arabidopsis thaliana clone 113229 mRNA, complete sequence	NA	coding protein	psRNATarget
AY093106.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||* targets:1073   GUGCUCUCUCUCUUCUGUCAU   1093 Target Full Sequence	2.5	Arabidopsis thaliana unknown protein (At5g50570) mRNA, complete cds	NA	coding protein	psRNATarget
AK117475.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||* targets:968   GUGCUCUCUCUCUUCUGUCAU   988 Target Full Sequence	2.5	Arabidopsis thaliana At5g50670 mRNA for unknown protein, complete cds, clone: RAFL17-08-M12	NA	coding protein	psRNATarget
AY128816.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   |||||||||*||||||||||* targets:332   GUGCUCUCUCUCUUCUGUCAU   352 Target Full Sequence	2.5	Arabidopsis thaliana unknown protein (At5g50570) mRNA, complete cds	NA	coding protein	psRNATarget
NM_104194.4	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   *||||||||*||||||||||* targets:750   CUGCUCUCUCUCUUCUGUCAU   770 Target Full Sequence	2.5	Arabidopsis thaliana squamosa promoter binding protein-like 4 (SPL4), mRNA	squamosa promoter binding protein-like 4(SPL4)	coding protein	psRNATarget
AY084902.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   *||||||||*||||||||||* targets:586   CUGCUCUCUCUCUUCUGUCAU   606 Target Full Sequence	2.5	Arabidopsis thaliana clone 12071 mRNA, complete sequence	NA	coding protein	psRNATarget
BT002856.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   *||||||||*||||||||||* targets:593   CUGCUCUCUCUCUUCUGUCAU   613 Target Full Sequence	2.5	Arabidopsis thaliana clone RAFL15-05-B10 (R20352) putative transcription factor (At1g53160) mRNA, complete cds	NA	coding protein	psRNATarget
AJ011632.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   *||||||||*||||||||||* targets:514   CUGCUCUCUCUCUUCUGUCAU   534 Target Full Sequence	2.5	Arabidopsis thaliana (ecotype Landsberg erecta) mRNA for squamosa promoter binding protein-like 4, partial	NA	coding protein	psRNATarget
AJ011631.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   *||||||||*||||||||||* targets:558   CUGCUCUCUCUCUUCUGUCAU   578 Target Full Sequence	2.5	Arabidopsis thaliana (ecotype Columbia) mRNA for squamosa promoter binding protein-like 4	NA	coding protein	psRNATarget
BX818213.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   *||||||||*||||||||||* targets:531   CUGCUCUCUCUCUUCUGUCAU   551 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL66ZF03 of Silique of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BT004391.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   *||||||||*||||||||||* targets:535   CUGCUCUCUCUCUUCUGUCAU   555 Target Full Sequence	2.5	Arabidopsis thaliana clone U20352 putative transcription factor (At1g53160) mRNA, complete cds	NA	coding protein	psRNATarget
NM_112390.5	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   **|||||||*||||||||||* targets:1620   CCGCUCUCUCUCUUCUGUCAU   1640 Target Full Sequence	2.5	Arabidopsis thaliana squamosa promoter binding protein-like 5 (SPL5), mRNA	squamosa promoter binding protein-like 5(SPL5)	coding protein	psRNATarget
AK118611.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   **|||||||*||||||||||* targets:680   CCGCUCUCUCUCUUCUGUCAU   700 Target Full Sequence	2.5	Arabidopsis thaliana At3g15270 mRNA for squamosa promoter binding protein-like 5, putative, complete cds, clone: RAFL19-86-N19	NA	coding protein	psRNATarget
AJ011610.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   **|||||||*||||||||||* targets:633   CCGCUCUCUCUCUUCUGUCAU   653 Target Full Sequence	2.5	Arabidopsis thaliana (ecotype Landsberg erecta) mRNA for squamosa promoter binding protein-like 5	NA	coding protein	psRNATarget
AJ242960.1	ncRNA:21   CACGAGAGAUAGAAGACAGUU   1   **|||||||*||||||||||* targets:633   CCGCUCUCUCUCUUCUGUCAU   653 Target Full Sequence	2.5	Arabidopsis thaliana mRNA for Squamosa promoter binding protein-like 5, (SPL5 gene)	NA	coding protein	psRNATarget

Reference

1	PMID:12101121 "MicroRNAs in plants"; Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP; Genes Dev. 16:1616-1626(2002).
2	PMID:12202040 "Prediction of plant microRNA targets"; Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP; Cell. 110:513-520(2002).
3	PMID:16040653 "Expression of Arabidopsis MIRNA genes"; Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC; Plant Physiol. 138:2145-2154(2005).
4	PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"; Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC; Genome Res. 16:1276-1288(2006).
5	PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"; Rajagopalan R, Vaucheret H, Trejo J, Bartel DP; Genes Dev. 20:3407-3425(2006).
6	PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"; Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW; J Exp Bot. 61:165-177(2010).