ncRNA ID | novel_bra_miR737 |
Species | Brassica rapa |
Class | miRNA |
Genome position | ChrA1:17169306-17169420 [+] |
Reference genome | Brapa_1.0 |
Source | SRR2912891;SRR2912894;SRR1485275 |
Length | 21 |
Mature sequence(if miRNA) | 95 - AUCGUUAGCUUUGUUGAAAUU - 115 |
Stem-loop(if miRNA) |
--               A                  A  AC UUUGUUGAAAUAUCUC   UUUCAACAAAGCUAA GAUCUCAAGAAAAAAAAA GA  U                A   ||||||||||||||| |||||||||||||||||| ||  |   AAAGUUGUUUCGAUU CUAGGGUUCUUUUUUUUU CU  C                A UU               G                  -  AA ACAAGAAAAAAAAAAG |
Stem-loop sequence | UUUCAACAAAGCUAAAGAUCUCAAGAAAAAAAAAAGAACUUUUGUUGAAAUAUCUCAAGAAAAAAAAAAGAACACAAUCUUUUUUUUUCUUGGGAUCGUUAGCUUUGUUGAAAUU |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
XM_009133639.2 |
|
2.5 | PREDICTED: Brassica rapa putative SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A member 3-like 2 (LOC103856528), mRNA | putative SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A member 3-like 2(LOC103856528) | coding protein | psRNATarget | |||||||||
XM_009113742.2 |
|
3.0 | PREDICTED: Brassica rapa pentatricopeptide repeat-containing protein At5g61400 (LOC103837380), transcript variant X1, mRNA | pentatricopeptide repeat-containing protein At5g61400(LOC103837380) | coding protein | psRNATarget | |||||||||
XM_009113743.2 |
|
3.0 | PREDICTED: Brassica rapa pentatricopeptide repeat-containing protein At5g61400 (LOC103837380), transcript variant X2, mRNA | pentatricopeptide repeat-containing protein At5g61400(LOC103837380) | coding protein | psRNATarget |