Search result

BaseInfo

ncRNA ID	ath-miRf10774-npr
Species	Arabidopsis thaliana
Class	miRNA
Genome position	NA
Reference genome	NA
Source	PNRD
Length	20
Mature sequence(if miRNA)	NA - AUAUCUUGAUCUUUCCACCA - NA
Stem-loop(if miRNA)	---   AA  -    AAAAAAA UAGGGAAUAUCUUGAUCUUUCCACCAUC   UAC  AG AAUA       A ||||||||||||||||||||||||||||   |||  || |||| AUUCCUUAUAGAACUAGAAAGGUGGUGG   AUG  UC UUAU       G                             UUU   GA  A    AACCUUC
Stem-loop sequence	UAGGGAAUAUCUUGAUCUUUCCACCAUCUACAAAGAAUAAAAAAAAAGCUUCCAAUAUUACUAGGUAUUUGGUGGUGGAAAGAUCAAGAUAUUCCUUA

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
BX824128.1	ncRNA:20   ACCACCUUUCUAGUUCUAUA   1   |||||||||||||||||||| targets:896   UGGUGGAAAGAUCAAGAUAU   915 Target Full Sequence	0.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH24ZF09 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
NM_114026.2	ncRNA:20   ACCACCUUUCUAGUUCUAUA   1   |||||||||||||||||||| targets:1005   UGGUGGAAAGAUCAAGAUAU   1024 Target Full Sequence	0.0	Arabidopsis thaliana Terpenoid cyclases/Protein prenyltransferases superfamily protein mRNA	Terpenoid cyclases/Protein prenyltransferases superfamily protein(AT3G32030)	coding protein	psRNATarget
NM_115642.2	ncRNA:20   ACCACCUUUCUAGUUCUAUA   1   ||||||||||||||||||** targets:1029   UGGUGGAAAGAUCAAGAUCA   1048 Target Full Sequence	2.5	Arabidopsis thaliana basic helix-loop-helix (bHLH) DNA-binding superfamily protein mRNA	basic helix-loop-helix (bHLH) DNA-binding superfamily protein(AT3G57800)	coding protein	psRNATarget
BX821436.1	ncRNA:20   ACCACCUUUCUAGUUCUAUA   1   ||||||=|||||||||||*| targets:1505   UGGUGGGAAGAUCAAGAUUU   1524 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL41ZD04 of Silique of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AY579213.1	ncRNA:20   ACCACCUUUCUAGUUCUAUA   1   |||*|||||||*|||||||| targets:4654   UGGCGGAAAGAACAAGAUAU   4673 Target Full Sequence	2.5	Arabidopsis thaliana trancription cofactor TAF250 (HAF2) mRNA, complete cds	NA	coding protein	psRNATarget
NM_112790.3	ncRNA:20   ACCACCUUUCUAGUUCUAUA   1   |||*|||||||*|||||||| targets:4654   UGGCGGAAAGAACAAGAUAU   4673 Target Full Sequence	2.5	Arabidopsis thaliana histone acetyltransferase of the TAFII250 family 2 (HAF2), partial mRNA	histone acetyltransferase of the TAFII250 family 2(HAF2)	coding protein	psRNATarget
NM_001338377.1	ncRNA:20   ACCACCUUUCUAGUUCUAUA   1   |||*|||||||*|||||||| targets:4733   UGGCGGAAAGAACAAGAUAU   4752 Target Full Sequence	2.5	Arabidopsis thaliana histone acetyltransferase of the TAFII250 family 2 (HAF2), mRNA	histone acetyltransferase of the TAFII250 family 2(HAF2)	coding protein	psRNATarget