Search result

BaseInfo

ncRNA ID	ath-miRf10754-npr
Species	Arabidopsis thaliana
Class	miRNA
Genome position	NA
Reference genome	NA
Source	PNRD
Length	20
Mature sequence(if miRNA)	NA - UCCUCCACCACCGAGAGCAU - NA
Stem-loop(if miRNA)	AC AC       A  GA  G UCCUCC  C  CGAGAGC UU  CG C ||||||  |  ||||||| ||  || AGGAGG  G  GCUCUCG GG  GC G       GC GC       A  AG  G
Stem-loop sequence	UCCUCCACCACCGAGAGCAUUGACGGCGGCGGAGGAGCUCUCGCGGCGGGAGGA

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
NM_111741.3	ncRNA:20   UACGAGAGCCACCACCUCCU   1   |||||||||||||||||||| targets:1621   AUGCUCUCGGUGGUGGAGGA   1640 Target Full Sequence	0.0	Arabidopsis thaliana LOW protein: UPF0503-like protein, putative (DUF740) (OPS), mRNA	LOW protein: UPF0503-like protein, putative (DUF740)(OPS)	coding protein	psRNATarget
AK226807.1	ncRNA:20   UACGAGAGCCACCACCUCCU   1   |||||||||||||||||||| targets:1422   AUGCUCUCGGUGGUGGAGGA   1441 Target Full Sequence	0.0	Arabidopsis thaliana mRNA for hypothetical protein, complete cds, clone: RAFL07-91-M03	NA	coding protein	psRNATarget
NM_103931.4	ncRNA:20   UACGAGAGCCACCACCUCCU   1   |||*||||||||*||||||| targets:1087   AUGAUCUCGGUGUUGGAGGA   1106 Target Full Sequence	2.5	Arabidopsis thaliana 10-formyltetrahydrofolate synthetase (THFS), mRNA	10-formyltetrahydrofolate synthetase(THFS)	coding protein	psRNATarget
AY054637.1	ncRNA:20   UACGAGAGCCACCACCUCCU   1   |||*||||||||*||||||| targets:1006   AUGAUCUCGGUGUUGGAGGA   1025 Target Full Sequence	2.5	Arabidopsis thaliana 10-formyltetrahydrofolate synthetase (At1g50480; F17J6.2) mRNA, complete cds	NA	coding protein	psRNATarget
BX818722.1	ncRNA:20   UACGAGAGCCACCACCUCCU   1   |||*||||||||*||||||| targets:962   AUGAUCUCGGUGUUGGAGGA   981 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL94ZH05 of Silique of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AF162279.1	ncRNA:20   UACGAGAGCCACCACCUCCU   1   |||*||||||||*||||||| targets:908   AUGAUCUCGGUGUUGGAGGA   927 Target Full Sequence	2.5	Arabidopsis thaliana 10-formyltetrahydrofolate synthetase (THFS) mRNA, complete cds	NA	coding protein	psRNATarget
AY081549.1	ncRNA:20   UACGAGAGCCACCACCUCCU   1   |||*||||||||*||||||| targets:905   AUGAUCUCGGUGUUGGAGGA   924 Target Full Sequence	2.5	Arabidopsis thaliana 10-formyltetrahydrofolate synthetase (At1g50480) mRNA, complete cds	NA	coding protein	psRNATarget
NM_130366.3	ncRNA:20   UACGAGAGCCACCACCUCCU   1   *||*||||||||*||||||| targets:1316   CUGGUCUCGGUGUUGGAGGA   1335 Target Full Sequence	2.5	Arabidopsis thaliana transducin family protein / WD-40 repeat family protein (SWA1), mRNA	transducin family protein / WD-40 repeat family protein(SWA1)	coding protein	psRNATarget
AK118137.1	ncRNA:20   UACGAGAGCCACCACCUCCU   1   *||*||||||||*||||||| targets:1316   CUGGUCUCGGUGUUGGAGGA   1335 Target Full Sequence	2.5	Arabidopsis thaliana At2g47990 mRNA for unknown protein, complete cds, clone: RAFL19-43-N24	NA	coding protein	psRNATarget
BX820529.1	ncRNA:20   UACGAGAGCCACCACCUCCU   1   *||*||||||||*||||||| targets:1302   CUGGUCUCGGUGUUGGAGGA   1321 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH44ZG11 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BT015524.1	ncRNA:20   UACGAGAGCCACCACCUCCU   1   *||*||||||||*||||||| targets:1237   CUGGUCUCGGUGUUGGAGGA   1256 Target Full Sequence	2.5	Arabidopsis thaliana At2g47990 mRNA sequence	NA	coding protein	psRNATarget
NM_117477.3	ncRNA:20   UACGAGAGCCACCACCUCCU   1   **|||=*||||||||||||| targets:292   CAGCUUCCGGUGGUGGAGGA   311 Target Full Sequence	3.0	Arabidopsis thaliana Rapid alkalinization factor (RALF) family protein mRNA	Rapid alkalinization factor (RALF) family protein(AT4G14020)	coding protein	psRNATarget
AY085168.1	ncRNA:20   UACGAGAGCCACCACCUCCU   1   **|||=*||||||||||||| targets:279   CAGCUUCCGGUGGUGGAGGA   298 Target Full Sequence	3.0	Arabidopsis thaliana clone 13520 mRNA, complete sequence	NA	coding protein	psRNATarget
BX826899.1	ncRNA:20   UACGAGAGCCACCACCUCCU   1   **|||=*||||||||||||| targets:262   CAGCUUCCGGUGGUGGAGGA   281 Target Full Sequence	3.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB74ZA10 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AK227416.1	ncRNA:20   UACGAGAGCCACCACCUCCU   1   **|||=*||||||||||||| targets:248   CAGCUUCCGGUGGUGGAGGA   267 Target Full Sequence	3.0	Arabidopsis thaliana mRNA for hypothetical protein, complete cds, clone: RAFL14-07-C12	NA	coding protein	psRNATarget
BT004746.1	ncRNA:20   UACGAGAGCCACCACCUCCU   1   **|||=*||||||||||||| targets:248   CAGCUUCCGGUGGUGGAGGA   267 Target Full Sequence	3.0	Arabidopsis thaliana At4g14020 gene, complete cds	NA	coding protein	psRNATarget
AK221242.1	ncRNA:20   UACGAGAGCCACCACCUCCU   1   |||*|*|||||||||||||* targets:2070   AUGAUGUCGGUGGUGGAGGU   2089 Target Full Sequence	3.0	Arabidopsis thaliana mRNA for receptor protein kinase-like, complete cds, clone: RAFL24-01-J08	NA	coding protein	psRNATarget
NM_001344855.1	ncRNA:20   UACGAGAGCCACCACCUCCU   1   |||*|*|||||||||||||* targets:2146   AUGAUGUCGGUGGUGGAGGU   2165 Target Full Sequence	3.0	Arabidopsis thaliana Leucine-rich repeat protein kinase family protein partial mRNA	Leucine-rich repeat protein kinase family protein(AT5G49780)	coding protein	psRNATarget
NM_001344856.1	ncRNA:20   UACGAGAGCCACCACCUCCU   1   |||*|*|||||||||||||* targets:2080   AUGAUGUCGGUGGUGGAGGU   2099 Target Full Sequence	3.0	Arabidopsis thaliana Leucine-rich repeat protein kinase family protein partial mRNA	Leucine-rich repeat protein kinase family protein(AT5G49780)	coding protein	psRNATarget
NM_124356.5	ncRNA:20   UACGAGAGCCACCACCUCCU   1   |||*|*|||||||||||||* targets:1771   AUGAUGUCGGUGGUGGAGGU   1790 Target Full Sequence	3.0	Arabidopsis thaliana Leucine-rich repeat protein kinase family protein partial mRNA	Leucine-rich repeat protein kinase family protein(AT5G49780)	coding protein	psRNATarget