Search result

BaseInfo

ncRNA ID	ath-miRf10751-npr
Species	Arabidopsis thaliana
Class	miRNA
Genome position	NA
Reference genome	NA
Source	PNRD
Length	20
Mature sequence(if miRNA)	NA - CUUGUGGAGAGGAAGCAAGA - NA
Stem-loop(if miRNA)	U                GA          G          G        -------------AUAU  GGCCCUUAAAA  UGUAAUUUCUUGUGGA  GGAAGCAAGA GAUGUGCUUG UUGUGGAA                 AG           U  ||||||||||||||||  |||||||||| |||||||||| ||||||||                 ||  ACAUUAAAGAACACCU  CCUUCGUUCU CUACACGAAU AACACCUU                 UU           A A                --          A          G        AAAAACAAUACACUCAC  AUGCUACUUAU
Stem-loop sequence	UUGUAAUUUCUUGUGGAGAGGAAGCAAGAGGAUGUGCUUGGUUGUGGAAAUAUAGGGCCCUUAAAAUAUAUUCAUCGUAUUCACUCACAUAACAAAAAUUCCACAAGUAAGCACAUCAUCUUGCUUCCUCCACAAGAAAUUACAA

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
NM_001338546.1	ncRNA:20   AGAACGAAGGAGAGGUGUUC   1   *||||*|||||||||||||| targets:1682   CCUUGAUUCCUCUCCACAAG   1701 Target Full Sequence	1.0	Arabidopsis thaliana Protein phosphatase 2A regulatory B subunit family protein mRNA	Protein phosphatase 2A regulatory B subunit family protein(AT3G21650)	coding protein	psRNATarget
NM_113060.5	ncRNA:20   AGAACGAAGGAGAGGUGUUC   1   *||||*|||||||||||||| targets:1623   CCUUGAUUCCUCUCCACAAG   1642 Target Full Sequence	1.0	Arabidopsis thaliana Protein phosphatase 2A regulatory B subunit family protein mRNA	Protein phosphatase 2A regulatory B subunit family protein(AT3G21650)	coding protein	psRNATarget
BX823131.1	ncRNA:20   AGAACGAAGGAGAGGUGUUC   1   *||||*|||||||||||||| targets:1566   CCUUGAUUCCUCUCCACAAG   1585 Target Full Sequence	1.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB92ZD03 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AK227037.1	ncRNA:20   AGAACGAAGGAGAGGUGUUC   1   *||||*|||||||||||||| targets:1333   CCUUGAUUCCUCUCCACAAG   1352 Target Full Sequence	1.0	Arabidopsis thaliana mRNA for putative B' regulatory subunit of PP2A, complete cds, clone: RAFL09-56-F08	NA	coding protein	psRNATarget
NM_113507.3	ncRNA:20   AGAACGAAGGAGAGGUGUUC   1   |||||*|||||||*|||||| targets:1642   UCUUGAUUCCUCUGCACAAG   1661 Target Full Sequence	2.5	Arabidopsis thaliana serine/threonine protein phosphatase 2A 55 kDa regulatory subunit B prime delta (ATB' DELTA), mRNA	serine/threonine protein phosphatase 2A 55 kDa regulatory subunit B prime delta(ATB' DELTA)	coding protein	psRNATarget
AF062396.1	ncRNA:20   AGAACGAAGGAGAGGUGUUC   1   |||||*|||||||*|||||| targets:1262   UCUUGAUUCCUCUGCACAAG   1281 Target Full Sequence	2.5	Arabidopsis thaliana protein phosphatase 2A regulatory subunit isoform B' delta mRNA, complete cds	NA	coding protein	psRNATarget
AY091037.1	ncRNA:20   AGAACGAAGGAGAGGUGUUC   1   |||||*|||||||*|||||| targets:1282   UCUUGAUUCCUCUGCACAAG   1301 Target Full Sequence	2.5	Arabidopsis thaliana putative protein phosphatase 2A regulatory subunit isoform B delta (At3g26030) mRNA, complete cds	NA	coding protein	psRNATarget
AY117349.1	ncRNA:20   AGAACGAAGGAGAGGUGUUC   1   |||||*|||||||*|||||| targets:854   UCUUGAUUCCUCUGCACAAG   873 Target Full Sequence	2.5	Arabidopsis thaliana putative protein phosphatase 2A regulatory subunit isoform B delta (At3g26030) mRNA, complete cds	NA	coding protein	psRNATarget