Search result

BaseInfo

ncRNA ID	ath-miRf10748-npr
Species	Arabidopsis thaliana
Class	miRNA
Genome position	NA
Reference genome	NA
Source	PNRD
Length	20
Mature sequence(if miRNA)	NA - AUCAUGAAGGAGAGAUCUUU - NA
Stem-loop(if miRNA)	UC   G      -                UCA  AAGU   GGA   UCA AAGAUC AUGAAGGAGAGAUCUU   GA    UUG   A   ||| |||||| ||||||||||||||||   ||    |||   GGU UUUUAG UACUUCUUUUCUAGAA   CU    GAC   U -A   G      A                ---  AAUU   GUA
Stem-loop sequence	UCUCAGAAGAUCAUGAAGGAGAGAUCUUUCAGAAAGUUUGGGAAUAUGCAGUUAAUCAAGAUCUUUUCUUCAUAGAUUUUGUGGA

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
NM_105216.5	ncRNA:20   UUUCUAGAGAGGAAGUACUA   1   ||||=|||||||||=||||| targets:286   AAAGGUCUCUCCUUUAUGAU   305 Target Full Sequence	2.5	Arabidopsis thaliana antigen receptor-like protein (DUF565) (NPQ7), mRNA	antigen receptor-like protein (DUF565)(NPQ7)	coding protein	psRNATarget
BX817510.1	ncRNA:20   UUUCUAGAGAGGAAGUACUA   1   ||||=|||||||||=||||| targets:226   AAAGGUCUCUCCUUUAUGAU   245 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL27ZH08 of Silique of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AY088215.1	ncRNA:20   UUUCUAGAGAGGAAGUACUA   1   ||||=|||||||||=||||| targets:248   AAAGGUCUCUCCUUUAUGAU   267 Target Full Sequence	2.5	Arabidopsis thaliana clone 4326 mRNA, complete sequence	NA	coding protein	psRNATarget
BT025776.1	ncRNA:20   UUUCUAGAGAGGAAGUACUA   1   ||||=|||||||||=||||| targets:52   AAAGGUCUCUCCUUUAUGAU   71 Target Full Sequence	2.5	Arabidopsis thaliana At1g65420 mRNA, complete cds	NA	coding protein	psRNATarget