ncRNA ID | ath-miR399b |
Species | Arabidopsis thaliana |
Class | miRNA |
Genome position | chr1:23345377-23345511 [-] |
Reference genome | TAIR10 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 11 - UGCCAAAGGAGAGUUGCCCUG - 31 |
Stem-loop(if miRNA) |
UC               C      A          C    CUUCCAA  -   CACAUACAUAUAUG   ACUAGUUUUAGGGCG CUCUCC UUGGCAGGUC UUUA       AU AUA              A   ||||||||||||||| |||||| |||||||||| ||||       || |||              A   UGGUCAAAGUCCCGU GAGAGG AACCGUCCAG AAAU       CU GUA              U CU               U      A          U    -AUUUAG  A   GCCUUUAAAAGCUA |
Stem-loop sequence | UCACUAGUUUUAGGGCGCCUCUCCAUUGGCAGGUCCUUUACUUCCAAAUAUACACAUACAUAUAUGAAUAUCGAAAAUUUCCGAUGAUCGAUUUAUAAAUGACCUGCCAAAGGAGAGUUGCCCUGAAACUGGUUC |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
AY074292.1 |
|
1.5 | Arabidopsis thaliana putative E2, ubiquitin-conjugating enzyme (At2g33770) mRNA, complete cds | NA | coding protein | psRNATarget | |||||||||
NM_179887.3 |
|
1.5 | Arabidopsis thaliana phosphate 2 (PHO2), mRNA | phosphate 2(PHO2) | coding protein | psRNATarget | |||||||||
AY074292.1 |
|
2.5 | Arabidopsis thaliana putative E2, ubiquitin-conjugating enzyme (At2g33770) mRNA, complete cds | NA | coding protein | psRNATarget | |||||||||
AY074292.1 |
|
2.5 | Arabidopsis thaliana putative E2, ubiquitin-conjugating enzyme (At2g33770) mRNA, complete cds | NA | coding protein | psRNATarget | |||||||||
AY074292.1 |
|
2.5 | Arabidopsis thaliana putative E2, ubiquitin-conjugating enzyme (At2g33770) mRNA, complete cds | NA | coding protein | psRNATarget | |||||||||
NM_179887.3 |
|
2.5 | Arabidopsis thaliana phosphate 2 (PHO2), mRNA | phosphate 2(PHO2) | coding protein | psRNATarget | |||||||||
NM_179887.3 |
|
2.5 | Arabidopsis thaliana phosphate 2 (PHO2), mRNA | phosphate 2(PHO2) | coding protein | psRNATarget | |||||||||
NM_179887.3 |
|
2.5 | Arabidopsis thaliana phosphate 2 (PHO2), mRNA | phosphate 2(PHO2) | coding protein | psRNATarget | |||||||||
AK316698.1 |
|
2.5 | Arabidopsis thaliana AT3G06500 mRNA, complete cds, clone: RAFL06-83-J15 | NA | coding protein | psRNATarget | |||||||||
AK226304.1 |
|
2.5 | Arabidopsis thaliana mRNA for putative neutral invertase, complete cds, clone: RAFL05-11-O20 | NA | coding protein | psRNATarget | |||||||||
BT008650.1 |
|
2.5 | Arabidopsis thaliana clone RAFL09-77-G24 (R19633) putative neutral invertase (At3g06500) mRNA, complete cds | NA | coding protein | psRNATarget | |||||||||
NM_111526.4 |
|
2.5 | Arabidopsis thaliana Plant neutral invertase family protein (A/N-InvC), mRNA | Plant neutral invertase family protein(A/N-InvC) | coding protein | psRNATarget | |||||||||
NM_001337660.1 |
|
2.5 | Arabidopsis thaliana Plant neutral invertase family protein (A/N-InvC), mRNA | Plant neutral invertase family protein(A/N-InvC) | coding protein | psRNATarget |
1 | PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"; Jones-Rhoades MW, Bartel DP; Mol Cell. 14:787-799(2004). |
2 | PMID:15258262
"Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis"; Sunkar R, Zhu JK; Plant Cell. 16:2001-2019(2004). |
3 | PMID:16040653
"Expression of Arabidopsis MIRNA genes"; Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC; Plant Physiol. 138:2145-2154(2005). |
4 | PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"; Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC; Genome Res. 16:1276-1288(2006). |
5 | PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"; Rajagopalan R, Vaucheret H, Trejo J, Bartel DP; Genes Dev. 20:3407-3425(2006). |
6 | PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"; Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW; J Exp Bot. 61:165-177(2010). |