ncRNA ID | ath-miR413 |
Species | Arabidopsis thaliana |
Class | miRNA |
Genome position | chr1:23058034-23058156 [+] |
Reference genome | TAIR10 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 6 - AUAGUUUCUCUUGUUCUGCAC - 26 |
Stem-loop(if miRNA) |
   CC        UCUUG       CAU    UAA    AGGAACCAUG     G  --  AG GAU  AUAGUUUC     UUCUGCA   CCAC   CUUC          UCCCA UU  UC  G |||  ||||||||     |||||||   ||||   ||||          ||||| ||  || CUG  UAUCAAGG     AAGACGU   GGUG   GAAG          AGGGU AA  AG  U    CU        --UCA       AUC    UUA    -GUAAACAAA     G  CU  AU |
Stem-loop sequence | GAUCCAUAGUUUCUCUUGUUCUGCACAUCCACUAACUUCAGGAACCAUGUCCCAGUUUCAGGUUAGAUCAAGUGGGAAAACAAAUGGAAGAUUGUGGCUAUGCAGAAACUGGAACUAUUCGUC |
1 | PMID:15345049
"Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets"; Wang XJ, Reyes JL, Chua NH, Gaasterland T; Genome Biol. 5:R65(2004). |
2 | PMID:16669754
"MicroRNAS and their regulatory roles in plants"; Jones-Rhoades MW, Bartel DP, Bartel B; Annu Rev Plant Biol. 57:19-53(2006). |