Search result

BaseInfo

ncRNA ID	ath-miRf10707-npr
Species	Arabidopsis thaliana
Class	miRNA
Genome position	NA
Reference genome	NA
Source	PNRD
Length	20
Mature sequence(if miRNA)	NA - UCUCUUGCAACCCAUCGAGA - NA
Stem-loop(if miRNA)	G  G    C            G GAA        A  UU UAGU AU UUCU UUGCAACCCAUC A   AGGGUUUA UC  G |||| || |||| |||||||||||| |   |||||||| || AUCA UA AAGA GACGUUGGGUAG U   UUUCGAAU AG  C     G  G    C            G --G        -  UA
Stem-loop sequence	UAGUGAUGUUCUCUUGCAACCCAUCGAGAAAGGGUUUAAUCUUGCAUGAUAAGCUUUGUGGAUGGGUUGCAGCAGAAGAUGACUA

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
BX818094.1	ncRNA:20   AGAGCUACCCAACGUUCUCU   1   |||||||||||||||||||| targets:602   UCUCGAUGGGUUGCAAGAGA   621 Target Full Sequence	0.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL60ZE12 of Silique of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AK222221.1	ncRNA:20   AGAGCUACCCAACGUUCUCU   1   |||||||||||||||||||| targets:615   UCUCGAUGGGUUGCAAGAGA   634 Target Full Sequence	0.0	Arabidopsis thaliana mRNA for hypothetical protein, complete cds, clone: RAFL25-29-M09	NA	coding protein	psRNATarget
EF183269.1	ncRNA:20   AGAGCUACCCAACGUUCUCU   1   |||||||||||||||||||| targets:684   UCUCGAUGGGUUGCAAGAGA   703 Target Full Sequence	0.0	Arabidopsis thaliana clone asmbl_4219 unknown mRNA sequence	NA	coding protein	psRNATarget
NM_001084363.2	ncRNA:20   AGAGCUACCCAACGUUCUCU   1   |||||||||||||||||||| targets:934   UCUCGAUGGGUUGCAAGAGA   953 Target Full Sequence	0.0	Arabidopsis thaliana LYR family of Fe/S cluster biogenesis protein mRNA	LYR family of Fe/S cluster biogenesis protein(AT1G76065)	coding protein	psRNATarget