Search result

BaseInfo

ncRNA ID ath-miR171c-5p
Species Arabidopsis thaliana
Class miRNA
Genome position chr1:22930089-22930204 [-]
Reference genome TAIR10
Source miRBase
Length 21
Mature sequence(if miRNA) 69 - AGAUAUUGGUGCGGUUCAAUC - 89
Stem-loop(if miRNA)        ACUA   GACAUCAAAUACGAGAUAUUGGUGCGGUUCAAUCAGAAAACCGU
UGAGCGC    UCG                                            A
|||||||    |||
AUUUGCG    CUA                                            C
       --CA   UAACCGUGCCGAGUUAGUUUAUUUGGCUAGAAAUUUUGUUUUCU
Stem-loop sequence UGAGCGCACUAUCGGACAUCAAAUACGAGAUAUUGGUGCGGUUCAAUCAGAAAACCGUACUCUUUUGUUUUAAAGAUCGGUUUAUUUGAUUGAGCCGUGCCAAUAUCACGCGUUUA

Reference

1 PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA";
Jones-Rhoades MW, Bartel DP;
Mol Cell. 14:787-799(2004).
2 PMID:15258262
"Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis";
Sunkar R, Zhu JK;
Plant Cell. 16:2001-2019(2004).
3 PMID:16040653
"Expression of Arabidopsis MIRNA genes";
Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC;
Plant Physiol. 138:2145-2154(2005).
4 PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant";
Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC;
Genome Res. 16:1276-1288(2006).
5 PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana";
Rajagopalan R, Vaucheret H, Trejo J, Bartel DP;
Genes Dev. 20:3407-3425(2006).