Search result

BaseInfo

ncRNA ID	ath-miRf10703-npr
Species	Arabidopsis thaliana
Class	miRNA
Genome position	NA
Reference genome	NA
Source	PNRD
Length	20
Mature sequence(if miRNA)	NA - GAGGACUCCAAGUGUGGUUA - NA
Stem-loop(if miRNA)	-      CUC  UA AAACAUGUGGGAGGACUCCAAGUGUGGU UAUAUC   GG  U |||||||||||||||||||||||||||| ||||||   || UUUGUACACCCUCCUGAGGUUCACACCA GUGUAG   UC  U                             A      --C  UA
Stem-loop sequence	AAACAUGUGGGAGGACUCCAAGUGUGGUUAUAUCCUCGGUAUUAUCUCGAUGUGAACCACACUUGGAGUCCUCCCACAUGUUU

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
DQ027019.1	ncRNA:20   AUUGGUGUGAACCUCAGGAG   1   ||||||*||||||||||||* targets:267   UAACCAAACUUGGAGUCCUA   286 Target Full Sequence	2.0	Arabidopsis thaliana ubiquitinating enzyme (At5g41340) mRNA, complete cds	NA	coding protein	psRNATarget
AY096587.1	ncRNA:20   AUUGGUGUGAACCUCAGGAG   1   ||||||*||||||||||||* targets:267   UAACCAAACUUGGAGUCCUA   286 Target Full Sequence	2.0	Arabidopsis thaliana putative ubiquitin-conjugating enzyme E2-21 kD 1 (At5g41340) mRNA, complete cds	NA	coding protein	psRNATarget
AY065360.1	ncRNA:20   AUUGGUGUGAACCUCAGGAG   1   ||||||*||||||||||||* targets:441   UAACCAAACUUGGAGUCCUA   460 Target Full Sequence	2.0	Arabidopsis thaliana putative E2, ubiquitin-conjugating enzyme UBC4 (At5g41340) mRNA, complete cds	NA	coding protein	psRNATarget
NM_123499.5	ncRNA:20   AUUGGUGUGAACCUCAGGAG   1   ||||||*||||||||||||* targets:500   UAACCAAACUUGGAGUCCUA   519 Target Full Sequence	2.0	Arabidopsis thaliana ubiquitin conjugating enzyme 4 (UBC4), mRNA	ubiquitin conjugating enzyme 4(UBC4)	coding protein	psRNATarget
NM_001344399.1	ncRNA:20   AUUGGUGUGAACCUCAGGAG   1   ||||||*||||||||||||* targets:883   UAACCAAACUUGGAGUCCUA   902 Target Full Sequence	2.0	Arabidopsis thaliana ubiquitin conjugating enzyme 4 (UBC4), mRNA	ubiquitin conjugating enzyme 4(UBC4)	coding protein	psRNATarget
BX832125.1	ncRNA:20   AUUGGUGUGAACCUCAGGAG   1   ||||||*||||||||||||* targets:821   UAACCAAACUUGGAGUCCUA   840 Target Full Sequence	2.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH53ZC03 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BX832123.1	ncRNA:20   AUUGGUGUGAACCUCAGGAG   1   ||||||*||||||||||||* targets:822   UAACCAAACUUGGAGUCCUA   841 Target Full Sequence	2.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH53ZB04 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget