Search result

BaseInfo

ncRNA ID	ath-miRf10640-npr
Species	Arabidopsis thaliana
Class	miRNA
Genome position	NA
Reference genome	NA
Source	PNRD
Length	20
Mature sequence(if miRNA)	NA - UUGCCCUCUUCUGCAGCAGA - NA
Stem-loop(if miRNA)	-GA           UC  C  CA      AAU GAC   AAUUGCCCUCU  UG AG  GAAGAU   G |||   |||||||||||  || ||  |||||| UUG   UUGACGGGAGG  AC UU  CUUCUA   C    ACG           -C  U  AC      CCU
Stem-loop sequence	GACGAAAUUGCCCUCUUCUGCAGCAGAAGAUAAUGCUCCAUCUUCCAUUUCACGGAGGGCAGUUGCAGUU

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
AK229869.1	ncRNA:20   AGACGACGUCUUCUCCCGUU   1   |||||||||||||||||||| targets:559   UCUGCUGCAGAAGAGGGCAA   578 Target Full Sequence	0.0	Arabidopsis thaliana mRNA for putative chloroplast inner envelope protein, partial cds, clone: RAFL22-12-D05	NA	coding protein	psRNATarget
AY094426.1	ncRNA:20   AGACGACGUCUUCUCCCGUU   1   |||||||||||||||||||| targets:3109   UCUGCUGCAGAAGAGGGCAA   3128 Target Full Sequence	0.0	Arabidopsis thaliana At1g06940/F4H5_1 mRNA, complete cds	NA	coding protein	psRNATarget
AY099850.1	ncRNA:20   AGACGACGUCUUCUCCCGUU   1   |||||||||||||||||||| targets:3121   UCUGCUGCAGAAGAGGGCAA   3140 Target Full Sequence	0.0	Arabidopsis thaliana chloroplast inner envelope protein, putative (At1g06950) mRNA, complete cds	NA	coding protein	psRNATarget
NM_100568.4	ncRNA:20   AGACGACGUCUUCUCCCGUU   1   |||||||||||||||||||| targets:3159   UCUGCUGCAGAAGAGGGCAA   3178 Target Full Sequence	0.0	Arabidopsis thaliana translocon at the inner envelope membrane of chloroplasts 110 (TIC110), mRNA	translocon at the inner envelope membrane of chloroplasts 110(TIC110)	coding protein	psRNATarget