Search result

BaseInfo

ncRNA ID	ath-miRf10637-npr
Species	Arabidopsis thaliana
Class	miRNA
Genome position	NA
Reference genome	NA
Source	PNRD
Length	23
Mature sequence(if miRNA)	NA - AAAUUGAGACGAGCGUUGUCUCC - NA
Stem-loop(if miRNA)	C         -A  U    A    G    U    A UAGA GGAGACAAU  UC GUUU UAGU UCCU GACG A |||| |||||||||  || |||| |||| |||| |||| C GUCU CCUCUGUUG  AG CAGA GUUA AGGG CUGU A     -         CG  -    -    A    U    A
Stem-loop sequence	UAGACGGAGACAAUAUCUGUUUAUAGUGUCCUUGACGAACAAUGUCUGGGAAAUUGAGACGAGCGUUGUCUCCUCUG

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
NM_001345671.1	ncRNA:23   CCUCUGUUGCGAGCAGAGUUAAA   1   ||||||||||||||||||||||| targets:693   GGAGACAACGCUCGUCUCAAUUU   715 Target Full Sequence	0.0	Arabidopsis thaliana Integrase-type DNA-binding superfamily protein mRNA	Integrase-type DNA-binding superfamily protein(AT5G65130)	coding protein	psRNATarget
NM_125912.2	ncRNA:23   CCUCUGUUGCGAGCAGAGUUAAA   1   ||||||||||||||||||||||| targets:475   GGAGACAACGCUCGUCUCAAUUU   497 Target Full Sequence	0.0	Arabidopsis thaliana Integrase-type DNA-binding superfamily protein partial mRNA	Integrase-type DNA-binding superfamily protein(AT5G65130)	coding protein	psRNATarget
DQ653392.1	ncRNA:23   CCUCUGUUGCGAGCAGAGUUAAA   1   ||||||||||||||||||||||| targets:475   GGAGACAACGCUCGUCUCAAUUU   497 Target Full Sequence	0.0	Arabidopsis thaliana clone 0000013473_0000009703 unknown mRNA	NA	coding protein	psRNATarget
AY560858.1	ncRNA:23   CCUCUGUUGCGAGCAGAGUUAAA   1   ||||||||||||||||||||||| targets:475   GGAGACAACGCUCGUCUCAAUUU   497 Target Full Sequence	0.0	Arabidopsis thaliana putative AP2/EREBP transcription factor (At5g65130) mRNA, complete cds	NA	coding protein	psRNATarget
DQ447109.1	ncRNA:23   CCUCUGUUGCGAGCAGAGUUAAA   1   ||||||||||||||||||||||| targets:475   GGAGACAACGCUCGUCUCAAUUU   497 Target Full Sequence	0.0	Arabidopsis thaliana clone pENTR221-At5g65130 AP2 domain-containing transcription factor (At5g65130) mRNA, complete cds	NA	coding protein	psRNATarget
BT025723.1	ncRNA:23   CCUCUGUUGCGAGCAGAGUUAAA   1   ||||||||||||||||||||||| targets:475   GGAGACAACGCUCGUCUCAAUUU   497 Target Full Sequence	0.0	Arabidopsis thaliana At5g65130 mRNA, complete cds	NA	coding protein	psRNATarget
NM_105113.4	ncRNA:23   CCUCUGUUGCGAGCAGAGUUAAA   1   |||||**|||||||||||||||| targets:755   GGAGAAUACGCUCGUCUCAAUUU   777 Target Full Sequence	2.0	Arabidopsis thaliana Integrase-type DNA-binding superfamily protein mRNA	Integrase-type DNA-binding superfamily protein(AT1G64380)	coding protein	psRNATarget
BX814927.1	ncRNA:23   CCUCUGUUGCGAGCAGAGUUAAA   1   |||||**|||||||||||||||| targets:726   GGAGAAUACGCUCGUCUCAAUUU   748 Target Full Sequence	2.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS19ZE06 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BX815480.1	ncRNA:23   CCUCUGUUGCGAGCAGAGUUAAA   1   |||||**|||||||||||||||| targets:727   GGAGAAUACGCUCGUCUCAAUUU   749 Target Full Sequence	2.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS65ZB08 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BX815335.1	ncRNA:23   CCUCUGUUGCGAGCAGAGUUAAA   1   |||||**|||||||||||||||| targets:609   GGAGAAUACGCUCGUCUCAAUUU   631 Target Full Sequence	2.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS53ZB02 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AK228763.1	ncRNA:23   CCUCUGUUGCGAGCAGAGUUAAA   1   |||||**|||||||||||||||| targets:735   GGAGAAUACGCUCGUCUCAAUUU   757 Target Full Sequence	2.0	Arabidopsis thaliana mRNA for AP2-containing DNA-binding protein, complete cds, clone: RAFL16-09-E15	NA	coding protein	psRNATarget
BX814431.1	ncRNA:23   CCUCUGUUGCGAGCAGAGUUAAA   1   |||||**|||||||||||||||| targets:727   GGAGAAUACGCUCGUCUCAAUUU   749 Target Full Sequence	2.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB73ZD03 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BX817006.1	ncRNA:23   CCUCUGUUGCGAGCAGAGUUAAA   1   |||||**|||||||||||||||| targets:716   GGAGAAUACGCUCGUCUCAAUUU   738 Target Full Sequence	2.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH80ZC04 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AY560876.1	ncRNA:23   CCUCUGUUGCGAGCAGAGUUAAA   1   |||||**|||||||||||||||| targets:550   GGAGAAUACGCUCGUCUCAAUUU   572 Target Full Sequence	2.0	Arabidopsis thaliana putative AP2/EREBP transcription factor (At1g64380) mRNA, complete cds	NA	coding protein	psRNATarget
BT033082.1	ncRNA:23   CCUCUGUUGCGAGCAGAGUUAAA   1   |||||**|||||||||||||||| targets:550   GGAGAAUACGCUCGUCUCAAUUU   572 Target Full Sequence	2.0	Arabidopsis thaliana unknown protein (At1g64380) mRNA, complete cds	NA	coding protein	psRNATarget