Search result

BaseInfo

ncRNA ID	ath-miR426
Species	Arabidopsis thaliana
Class	miRNA
Genome position	chr1:22107346-22107456 [+]
Reference genome	TAIR10
Source	miRBase
Length	21
Mature sequence(if miRNA)	14 - UUUUGGAAAUUUGUCCUUACG - 34
Stem-loop(if miRNA)	--------G GGGACAAUUUUUGGAAAUUUGUCCUUACGGGUAGUACUAGAAUAC GAG         G                                             U |||         |                                             U CUC         U                                             G    AAAUUAAAA AAAAAAGGAGUAUACAGGAAGCCAAUAAAGUUUAGCAGUACACCU
Stem-loop sequence	GAGGGGGGACAAUUUUUGGAAAUUUGUCCUUACGGGUAGUACUAGAAUACUUGUCCACAUGACGAUUUGAAAUAACCGAAGGACAUAUGAGGAAAAAAUAAAAUUAAACUC

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
NM_121668.4	ncRNA:21   GCAUUCCUGUUUAAAGGUUUU   1   =*|||||=*|||||||||||| targets:1794   UUUAAGGGAAAAUUUCCAAAA   1814 Target Full Sequence	2.5	Arabidopsis thaliana hydroxyproline-rich glycoprotein family protein (TIC40), mRNA	hydroxyproline-rich glycoprotein family protein(TIC40)	coding protein	psRNATarget

Reference

1	PMID:15345049 "Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets"; Wang XJ, Reyes JL, Chua NH, Gaasterland T; Genome Biol. 5:R65(2004).
2	PMID:16669754 "MicroRNAS and their regulatory roles in plants"; Jones-Rhoades MW, Bartel DP, Bartel B; Annu Rev Plant Biol. 57:19-53(2006).