Search result

BaseInfo

ncRNA ID	ath-miRf10533-npr
Species	Arabidopsis thaliana
Class	miRNA
Genome position	NA
Reference genome	NA
Source	PNRD
Length	21
Mature sequence(if miRNA)	NA - ACUGGUUCAAACCGGUUUACA - NA
Stem-loop(if miRNA)	G     ---   U         AC   U C         A     --A   U AA AUAUG   GUA AACCGGUUU  ACU G CUUAACCAA AAAAU   AAA C || |||||   ||| |||||||||  ||| | ||||||||| |||||   ||| A UU UGUAC   CAU UUGGCCAAA  UGG C GAAUUGGUU UUUUG   UUU A   G     GUA   -         CU   U A         C     GUG   U
Stem-loop sequence	AAGAUAUGGUAUAACCGGUUUACACUUGCCUUAACCAAAAAAAUAAAAUCAAUUUUGUGGUUUUCUUGGUUAAGACUGGUUCAAACCGGUUUACAUGCAUGUGUU

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
AY117315.1	ncRNA:21   ACAUUUGGCCAAACUUGGUCA   1   ***|||||||||||||||||* targets:884   AAGAAACCGGUUUGAACCAGC   904 Target Full Sequence	2.0	Arabidopsis thaliana putative transcription factor (At3g51080) mRNA, complete cds	NA	coding protein	psRNATarget
BX822494.1	ncRNA:21   ACAUUUGGCCAAACUUGGUCA   1   ***|||||||||||||||||* targets:1019   AAGAAACCGGUUUGAACCAGC   1039 Target Full Sequence	2.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB41ZC11 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AY064048.1	ncRNA:21   ACAUUUGGCCAAACUUGGUCA   1   ***|||||||||||||||||* targets:935   AAGAAACCGGUUUGAACCAGC   955 Target Full Sequence	2.0	Arabidopsis thaliana putative transcription factor (At3g51080) mRNA, complete cds	NA	coding protein	psRNATarget
NM_114968.4	ncRNA:21   ACAUUUGGCCAAACUUGGUCA   1   ***|||||||||||||||||* targets:1105   AAGAAACCGGUUUGAACCAGC   1125 Target Full Sequence	2.0	Arabidopsis thaliana GATA transcription factor 6 (GATA6), mRNA	GATA transcription factor 6(GATA6)	coding protein	psRNATarget
BT015119.1	ncRNA:21   ACAUUUGGCCAAACUUGGUCA   1   *|||=|=*||||||||||||| targets:576   GGUAGAUGGGUUUGAACCAGU   596 Target Full Sequence	3.0	Arabidopsis thaliana At5g23730 gene, complete cds	NA	coding protein	psRNATarget
AY039941.1	ncRNA:21   ACAUUUGGCCAAACUUGGUCA   1   *|||=|=*||||||||||||| targets:920   GGUAGAUGGGUUUGAACCAGU   940 Target Full Sequence	3.0	Arabidopsis thaliana unknown protein (At5g23730) mRNA, complete cds	NA	coding protein	psRNATarget
NM_122278.4	ncRNA:21   ACAUUUGGCCAAACUUGGUCA   1   *|||=|=*||||||||||||| targets:1140   GGUAGAUGGGUUUGAACCAGU   1160 Target Full Sequence	3.0	Arabidopsis thaliana Transducin/WD40 repeat-like superfamily protein (RUP2), mRNA	Transducin/WD40 repeat-like superfamily protein(RUP2)	coding protein	psRNATarget