Search result

BaseInfo

ncRNA ID	novel_ath_miR960
Species	Arabidopsis thaliana
Class	miRNA
Genome position	Chr2:1761683-1761767 [+]
Reference genome	TAIR10
Source	SRR1262546
Length	23
Mature sequence(if miRNA)	1 - UUGUCCCAGUUGGCCGGUCAAUA - 23
Stem-loop(if miRNA)	--UUGUCCCA              ACAC        --                GUUGGCCGGUCAAU    AUAAUUUA  CAAUAC           ||||||||||||||    ||||||||  |||||A           UAACUGGCCGGUUG    UGUUGAAU  GUUAUA UCAAUACACA              AACC        CG
Stem-loop sequence	UUGUCCCAGUUGGCCGGUCAAUACACAUAAUUUACAAUACAAUAUUGGCUAAGUUGUCCAAGUUGGCCGGUCAAUACACAUAACU

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
EF183124.1	ncRNA:23   AUAACUGGCCGGUUGACCCUGUU   1   ||||||||||||||||||||||| targets:461   UAUUGACCGGCCAACUGGGACAA   483 Target Full Sequence	0.0	Arabidopsis thaliana clone asmbl_1537 unknown mRNA sequence	NA	coding protein	psRNATarget
NM_001332625.1	ncRNA:23   AUAACUGGCCGGUUGACCCUGUU   1   |||||||||*||||||||||||| targets:583   UAUUGACCGACCAACUGGGACAA   605 Target Full Sequence	1.0	Arabidopsis thaliana hypothetical protein mRNA	hypothetical protein(AT1G23915)	coding protein	psRNATarget
NM_001332625.1	ncRNA:23   AUAACUGGCCGGUUGACCCUGUU   1   |||||||||||||||*||||||| targets:634   UAUUGACCGGCCAACCGGGACAA   656 Target Full Sequence	1.5	Arabidopsis thaliana hypothetical protein mRNA	hypothetical protein(AT1G23915)	coding protein	psRNATarget
EF183089.1	ncRNA:23   AUAACUGGCCGGUUGACCCUGUU   1   ||||||||||||||*|||||||| targets:630   UAUUGACCGGCCAAGUGGGACAA   652 Target Full Sequence	1.5	Arabidopsis thaliana clone asmbl_13067 unknown mRNA sequence	NA	coding protein	psRNATarget
BX822096.1	ncRNA:23   AUAACUGGCCGGUUGACCCUGUU   1   *|*|||||*|||||||||||*|| targets:461   AAGUGACCAGCCAACUGGGAGAA   483 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB11ZG07 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BX822097.1	ncRNA:23   AUAACUGGCCGGUUGACCCUGUU   1   *|*|||||*|||||||||||*|| targets:461   AAGUGACCAGCCAACUGGGAGAA   483 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB11ZG08 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AY150404.1	ncRNA:23   AUAACUGGCCGGUUGACCCUGUU   1   *|*|||||*|||||||||||*|| targets:748   AAGUGACCAGCCAACUGGGAGAA   770 Target Full Sequence	2.5	Arabidopsis thaliana unknown protein (At3g12760) mRNA, complete cds	NA	coding protein	psRNATarget
BX824136.1	ncRNA:23   AUAACUGGCCGGUUGACCCUGUU   1   *|*|||||*|||||||||||*|| targets:939   AAGUGACCAGCCAACUGGGAGAA   961 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH25ZB03 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AY050926.1	ncRNA:23   AUAACUGGCCGGUUGACCCUGUU   1   *|*|||||*|||||||||||*|| targets:972   AAGUGACCAGCCAACUGGGAGAA   994 Target Full Sequence	2.5	Arabidopsis thaliana unknown protein (At3g12760) mRNA, complete cds	NA	coding protein	psRNATarget
NM_112112.3	ncRNA:23   AUAACUGGCCGGUUGACCCUGUU   1   *|*|||||*|||||||||||*|| targets:987   AAGUGACCAGCCAACUGGGAGAA   1009 Target Full Sequence	2.5	Arabidopsis thaliana defective in cullin neddylation protein mRNA	defective in cullin neddylation protein(AT3G12760)	coding protein	psRNATarget